Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Yersinia entomophaga 5S ribosomal RNA secondary structure diagram

Yersinia entomophaga 5S ribosomal RNA URS00000D32F3_935293

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGGCGGCAAUAGCGCGGUGGUCCCACCUGAUCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGACACUGCCAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Serratia marcescens 5S ribosomal RNA
  2. Serratia proteamaculans 568 5S ribosomal RNA
  3. Serratia proteamaculans 5S ribosomal RNA
  4. Serratia quinivorans 5S ribosomal RNA
  5. Serratia sp. CC22-02 5S rRNA. Bacterial TSU
  6. Yersinia nurmii 5S ribosomal RNA
2D structure