v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Serratia sp. CC22-02 5S rRNA. Bacterial TSU secondary structure diagram

Serratia sp. CC22-02 5S rRNA. Bacterial TSU URS00000D32F3_1378076

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCUGGCGGCAAUAGCGCGGUGGUCCCACCUGAUCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGACACUGCCAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Serratia marcescens 5S ribosomal RNA
  2. Serratia proteamaculans 568 5S ribosomal RNA
  3. Serratia proteamaculans 5S ribosomal RNA
  4. Serratia quinivorans 5S ribosomal RNA
  5. Yersinia entomophaga 5S ribosomal RNA
  6. Yersinia nurmii 5S ribosomal RNA
 2D structure