Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-361 URS00000CF1D2_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUCAGAAUCUCCAGGGGUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Bos taurus bta-miR-361
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-361
  3. Capra hircus (goat) chi-miR-361-5p
  4. Cavia porcellus cpo-miR-361-5p
  5. Cervus elaphus (red deer) cel-miR-361
  6. Cricetulus griseus (Chinese hamster) cgr-miR-361
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-361-5p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-361-v1_5p (mature (guide))
  9. Eptesicus fuscus efu-miR-361
  10. Equus caballus eca-miR-361-5p
  11. Gorilla gorilla gorilla ggo-miR-361 (MIR361)
  12. Gorilla gorilla ggo-miR-361
  13. Homo sapiens (human) hsa-miR-361-5p
  14. Macaca mulatta mml-miR-361-5p
  15. Microcebus murinus mmr-miR-361
  16. Mus musculus (house mouse) mmu-miR-361-5p
  17. Nomascus leucogenys nle-miR-361
  18. Oryctolagus cuniculus ocu-miR-361-5p
  19. Otolemur garnettii oga-miR-361
  20. Pongo pygmaeus ppy-miR-361-5p
  21. Pteropus alecto pal-miR-361-5p
  22. Rattus norvegicus rno-miR-361-5p
  23. Sus scrofa ssc-miR-361-5p
Publications