Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-361-5p URS00000CF1D2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-361: Hsa-mir-361 is a specific microRNA (miRNA) that has been studied in various contexts. It has been included in cDNA synthesis and reverse transcription reactions using the TaqMan® MicroRNA Reverse Transcription Kit and specific RT primers [PMC7998231]. In paired tumor and normal samples, hsa-mir-361 showed lower absolute log fold change (LFC) compared to hsa-miR-16-5p [PMC8186776]. Hsa-mir-361 has not been extensively investigated in the context of common miRNAs, and further research is needed to determine its pan-cancer prognostic potential [PMC6602415]. It has been found to be upregulated in the third trimester of pregnancy, along with other miRNAs such as hsa-miR-let7e, hsa-miR-107, and hsa-miR-370 [PMC9700700]. In the first trimester of pregnancy, hsa-mir-361 was significantly upregulated in patients with gestational diabetes mellitus (GDM) [PMC9700700]. Hsa-mir-361 has also been implicated in various cancer types, including intestinal type T1N0M0 and T1N1M0 tumors [PMC4496000]. Additionally, it has been shown to play a role in cell fusion capacity enhancement and disease progression prediction [PMC4325962] [PMC8706837]. In breast cancer studies, hsa-mir-361 expression was found to be downregulated in docetaxel-resistant cells but upregulated in metastatic tumors. It also targets FGFR1 and MMP-1 genes involved in glycolysis inhibition and invasion inhibition [PMC6208346]. Furthermore, it regulates genes involved in the VEGF signaling pathway as well as genes involved in the TGF-beta signaling pathway [PMC7955132].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUCAGAAUCUCCAGGGGUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Bos taurus bta-miR-361
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-361
  3. Canis lupus familiaris cfa-miR-361
  4. Capra hircus (goat) chi-miR-361-5p
  5. Cavia porcellus cpo-miR-361-5p
  6. Cervus elaphus (red deer) cel-miR-361
  7. Cricetulus griseus (Chinese hamster) cgr-miR-361
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-361-5p
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-361-v1_5p (mature (guide))
  10. Eptesicus fuscus efu-miR-361
  11. Equus caballus eca-miR-361-5p
  12. Gorilla gorilla gorilla ggo-miR-361 (MIR361)
  13. Gorilla gorilla ggo-miR-361
  14. Macaca mulatta mml-miR-361-5p
  15. Microcebus murinus mmr-miR-361
  16. Mus musculus (house mouse) mmu-miR-361-5p
  17. Nomascus leucogenys nle-miR-361
  18. Oryctolagus cuniculus ocu-miR-361-5p
  19. Otolemur garnettii oga-miR-361
  20. Pongo pygmaeus ppy-miR-361-5p
  21. Pteropus alecto pal-miR-361-5p
  22. Rattus norvegicus rno-miR-361-5p
  23. Sus scrofa ssc-miR-361-5p
Publications