Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-361-5p URS00000CF1D2_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (LncBase, ENA, TarBase, PirBase, RefSeq, miRBase, MirGeneDB). Mus musculus (house mouse) mmu-miR-361-5p sequence is a product of miR-361-5p, Mir361, miR-361, mmu-miR-361-5p, mmu-miR-361 genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 2410071B14Rik, 2610206G21Rik, 2700090M07Rik, 4921524O04Rik, 4930471C18Rik, 5033418D15Rik, 636931, 8030409M04Rik, 9430029L20Rik, A430081P20Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUAUCAGAAUCUCCAGGGGUAC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Bos taurus bta-miR-361
    2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-361
    3. Canis lupus familiaris cfa-miR-361
    4. Capra hircus (goat) chi-miR-361-5p
    5. Cavia porcellus (domestic guinea pig) cpo-miR-361-5p
    6. Cervus elaphus (red deer) cel-miR-361
    7. Cricetulus griseus cgr-miR-361
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-361-5p
    9. Echinops telfairi Ete-Mir-361-v1_5p (mature (guide))
    10. Eptesicus fuscus (big brown bat) efu-miR-361
    11. Equus caballus (horse) eca-miR-361-5p
    12. Gorilla gorilla (western gorilla) ggo-miR-361
    13. Homo sapiens (human) hsa-miR-361-5p
    14. Macaca mulatta mml-miR-361-5p
    15. Microcebus murinus (gray mouse lemur) mmr-miR-361
    16. Nomascus leucogenys nle-miR-361
    17. Oryctolagus cuniculus (rabbit) ocu-miR-361-5p
    18. Otolemur garnettii oga-miR-361
    19. Pongo pygmaeus ppy-miR-361-5p
    20. Pteropus alecto (black flying fox) pal-miR-361-5p
    21. Rattus norvegicus (Norway rat) rno-miR-361-5p
    22. Sus scrofa (pig) ssc-miR-361-5p
    Publications New