Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mycobacterium rhodesiae 5S rRNA secondary structure diagram

Mycobacterium rhodesiae 5S rRNA URS00000CCCDC_36814

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACGGCGGUAAUAGCGACAGGGAAACGCCCGGACCCAUCCCGAACCCGGAAGCUAAGCCUGCCAGCGCCGAUGAUACUACCCACCCGGGUGGAAAAGUAGGACACCGCCGAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Mycobacterium eburneum 5S ribosomal RNA
  2. Candidatus Mycobacterium wuenschmannii 5S ribosomal RNA
  3. Mycobacterium talmoniae 5S ribosomal RNA
  4. Mycolicibacterium rhodesiae NBB3 5S ribosomal RNA
2D structure