Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mycobacterium eburneum 5S ribosomal RNA secondary structure diagram

Mycobacterium eburneum 5S ribosomal RNA URS00000CCCDC_2035343

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACGGCGGUAAUAGCGACAGGGAAACGCCCGGACCCAUCCCGAACCCGGAAGCUAAGCCUGCCAGCGCCGAUGAUACUACCCACCCGGGUGGAAAAGUAGGACACCGCCGAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Mycolicibacterium rhodesiae Mycobacterium rhodesiae 5S rRNA
  2. Candidatus Mycobacterium wuenschmannii 5S ribosomal RNA
  3. Mycobacterium talmoniae 5S ribosomal RNA
  4. Mycolicibacterium rhodesiae NBB3 5S ribosomal RNA
2D structure