Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-411-5p URS00000C5BAA_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MalaCards, LncBase, GeneCards, RefSeq, TarBase, miRBase, ENA, MirGeneDB). Described in 35 papers. Homo sapiens (human) hsa-miR-411-5p sequence is a product of hsa-miR-411-5p, MIR411, hsa-miR-411, miR-411, miR-411-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including ACG, ACKR3, AHNAK, ALS20, AMPD3, API2, APOLD1, ASMTL, BAZ2A, BCL1.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAGUAGACCGUAUAGCGUACG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Bos taurus (cattle) Bta-Mir-154-P13_5p (mature (guide))
    2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-411
    3. Canis lupus familiaris Cfa-Mir-154-P13_5p (mature (guide))
    4. Cavia porcellus (domestic guinea pig) cpo-miR-411-5p
    5. Dasypus novemcinctus dno-miR-411-5p
    6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P13_5p (mature (guide))
    7. Equus caballus eca-miR-411
    8. Macaca mulatta mml-miR-411-5p
    9. Microcebus murinus (gray mouse lemur) mmr-miR-411a
    10. Mus musculus mmu-miR-411-5p
    11. Oryctolagus cuniculus ocu-miR-411-5p
    12. Otolemur garnettii oga-miR-411a
    13. Pan paniscus (pygmy chimpanzee) ppa-miR-411a
    14. Pan troglodytes ptr-miR-411
    15. Papio hamadryas pha-miR-411a
    16. Pongo pygmaeus ppy-miR-411
    17. Rattus norvegicus (Norway rat) rno-miR-411-5p
    18. Tupaia chinensis tch-miR-411-5p