Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-411-5p URS00000C5BAA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-411: Hsa-mir-411 is a microRNA that is involved in various biological processes and diseases. It has been identified as a potential regulator in the pathogenesis of H. pylori-related gastric cancer (GC) [PMC7410007]. Additionally, hsa-mir-411 has been found to play a role in cancer drug resistance, specifically in drug efflux pathways [PMC9524264]. In the context of good prognosis, hsa-mir-411 is one of the hub microRNAs that are upregulated and may be involved in the negative regulation of transcription [PMC8004706]. Furthermore, hsa-mir-411 is one of the eight miRNAs identified as potential regulators based on miRNA target gene databases [PMC9585797]. In relation to hepatitis C virus (HCV) infection, hsa-mir-411, along with other microRNAs such as hsa-miR-122 and hsa-miR-199a, has been found to influence HCV replication [PMC9493126]. Overall, hsa-mir-411 is a versatile microRNA that has implications in various diseases and biological processes. However, further experimental studies are needed to fully understand its mechanism of action and its role in specific diseases such as H. pylori-related GC.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGUAGACCGUAUAGCGUACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Bos taurus Bta-Mir-154-P13_5p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-411
  3. Canis lupus familiaris Cfa-Mir-154-P13_5p (mature (guide))
  4. Cavia porcellus cpo-miR-411-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-411-5p
  6. Echinops telfairi Ete-Mir-154-P13_5p (mature (guide))
  7. Equus caballus eca-miR-411
  8. Macaca mulatta (Rhesus monkey) mml-miR-411-5p
  9. Microcebus murinus (gray mouse lemur) mmr-miR-411a
  10. Mus musculus (house mouse) mmu-miR-411-5p
  11. Oryctolagus cuniculus ocu-miR-411-5p
  12. Otolemur garnettii oga-miR-411a
  13. Pan paniscus (pygmy chimpanzee) ppa-miR-411a
  14. Pan troglodytes (chimpanzee) ptr-miR-411
  15. Papio hamadryas (hamadryas baboon) pha-miR-411a
  16. Pongo pygmaeus ppy-miR-411
  17. Rattus norvegicus (Norway rat) rno-miR-411-5p
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-411-5p
Publications