Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-411 URS00000C5BAA_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGUAGACCGUAUAGCGUACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus Bta-Mir-154-P13_5p (mature (guide))
  2. Callithrix jacchus cja-miR-411
  3. Canis lupus familiaris Cfa-Mir-154-P13_5p (mature (guide))
  4. Cavia porcellus cpo-miR-411-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-411-5p
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P13_5p (mature (guide))
  7. Homo sapiens hsa-miR-411-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-411-5p
  9. Microcebus murinus (gray mouse lemur) mmr-miR-411a
  10. Mus musculus mmu-miR-411-5p
  11. Oryctolagus cuniculus (rabbit) ocu-miR-411-5p
  12. Otolemur garnettii oga-miR-411a
  13. Pan paniscus ppa-miR-411a
  14. Pan troglodytes (chimpanzee) ptr-miR-411
  15. Papio hamadryas (hamadryas baboon) pha-miR-411a
  16. Pongo pygmaeus ppy-miR-411
  17. Rattus norvegicus (Norway rat) rno-miR-411-5p
  18. Tupaia chinensis tch-miR-411-5p
Publications