Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-411-5p URS00000C5BAA_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGUAGACCGUAUAGCGUACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Bos taurus Bta-Mir-154-P13_5p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-411
  3. Canis lupus familiaris Cfa-Mir-154-P13_5p (mature (guide))
  4. Cavia porcellus cpo-miR-411-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-411-5p
  6. Echinops telfairi Ete-Mir-154-P13_5p (mature (guide))
  7. Equus caballus eca-miR-411
  8. Homo sapiens (human) hsa-miR-411-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-411-5p
  10. Microcebus murinus (gray mouse lemur) mmr-miR-411a
  11. Mus musculus (house mouse) mmu-miR-411-5p
  12. Oryctolagus cuniculus ocu-miR-411-5p
  13. Otolemur garnettii oga-miR-411a
  14. Pan paniscus (pygmy chimpanzee) ppa-miR-411a
  15. Pan troglodytes (chimpanzee) ptr-miR-411
  16. Papio hamadryas (hamadryas baboon) pha-miR-411a
  17. Pongo pygmaeus ppy-miR-411
  18. Tupaia chinensis (Chinese tree shrew) tch-miR-411-5p
Publications