Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus laevis (African clawed frog) Xla-Mir-383-P1_5p (mature (guide)) URS00000C5969_8355

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUCAGAAGGUGAUUGUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 58 other species

  1. Alligator mississippiensis Ami-Mir-383-v1_5p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-383-v1_5p (mature (guide))
  3. Bos taurus bta-miR-383
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-383a
  5. Canis lupus familiaris cfa-miR-383
  6. Cavia porcellus cpo-miR-383-5p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-383-v1_5p (mature (guide))
  8. Chrysemys picta cpi-miR-383-5p
  9. Columba livia (rock pigeon) Cli-Mir-383-v1_5p (mature (guide))
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-383-5p
  11. Echinops telfairi Ete-Mir-383-v1_5p (mature (guide))
  12. Equus caballus eca-miR-383
  13. Gallus gallus gga-miR-383-5p
  14. Gekko japonicus Gja-Mir-383-v1_5p (mature (guide))
  15. Homo sapiens (human) hsa-miR-383-5p
  16. Macaca mulatta (Rhesus monkey) mml-miR-383
  17. Microcaecilia unicolor Mun-Mir-383_5p (mature (guide))
  18. Monodelphis domestica mdo-miR-383-5p
  19. Ophiophagus hannah (king cobra) oha-miR-383-5p
  20. Ornithorhynchus anatinus (platypus) Oan-Mir-383-v1_5p (mature (guide))
  21. Oryctolagus cuniculus ocu-miR-383-5p
  22. Pan troglodytes (chimpanzee) ptr-miR-383
  23. Pongo pygmaeus ppy-miR-383
  24. Pteropus alecto pal-miR-383-5p
  25. Python bivittatus pbv-miR-383-5p
  26. Sarcophilus harrisii Sha-Mir-383-v1_5p (mature (guide))
  27. Sphenodon punctatus (tuatara) Spt-Mir-383_5p (mature (guide))
  28. Taeniopygia guttata tgu-miR-383-5p
  29. Xenopus tropicalis (tropical clawed frog) xtr-miR-383