Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-miR-383 URS00000C5969_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUCAGAAGGUGAUUGUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-383-v1_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-383-v1_5p (mature (guide))
  3. Bos taurus bta-miR-383
  4. Callithrix jacchus cja-miR-383a
  5. Canis lupus familiaris cfa-miR-383
  6. Cavia porcellus cpo-miR-383-5p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-383-v1_5p (mature (guide))
  8. Chrysemys picta (Painted turtle) cpi-miR-383-5p
  9. Columba livia Cli-Mir-383-v1_5p (mature (guide))
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-383-5p
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-383-v1_5p (mature (guide))
  12. Equus caballus eca-miR-383
  13. Gallus gallus (chicken) gga-miR-383-5p
  14. Gekko japonicus Gja-Mir-383-v1_5p (mature (guide))
  15. Homo sapiens hsa-miR-383-5p
  16. Macaca mulatta (Rhesus monkey) mml-miR-383
  17. Microcaecilia unicolor Mun-Mir-383_5p (mature (guide))
  18. Monodelphis domestica mdo-miR-383-5p
  19. Ophiophagus hannah oha-miR-383-5p
  20. Ornithorhynchus anatinus Oan-Mir-383-v1_5p (mature (guide))
  21. Oryctolagus cuniculus (rabbit) ocu-miR-383-5p
  22. Pan troglodytes (chimpanzee) ptr-miR-383
  23. Pongo pygmaeus ppy-miR-383
  24. Pteropus alecto (black flying fox) pal-miR-383-5p
  25. Python bivittatus (Burmese python) pbv-miR-383-5p
  26. Sarcophilus harrisii Sha-Mir-383-v1_5p (mature (guide))
  27. Sphenodon punctatus (tuatara) Spt-Mir-383_5p (mature (guide))
  28. Taeniopygia guttata tgu-miR-383-5p
  29. Xenopus laevis (African clawed frog) Xla-Mir-383-P1_5p (mature (guide))
Publications