Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-339-5p URS00000BEB26_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-339: Ssc-mir-339 is a microRNA that has been studied in various contexts [PMC9454643]. In a study examining circRNA_08840, it was found that ssc-mir-339, along with ssc-miR-370, ssc-miR-127, ssc-mir-339-3p, and ssc-miR-7137-3p, showed higher levels of differential expression among potential binding sites for target miRNAs [PMC9454643]. In another study comparing Laiwu and Large White pigs, it was observed that ssc-mir-339 was downregulated in both pig breeds under the control group [PMC9454643]. The relevance of ssc-mir-339 was also highlighted in a study examining RIF1 scores [PMC6966835]. Furthermore, both circRNA–miRNA–lncRNA network analysis and mRNA–miRNA–lncRNA network analysis identified the involvement of ssc-mir-339 in regulatory networks [PMC8614448]. Overall, these studies demonstrate the importance of ssc-mir-339 in various biological processes and highlight its potential role as a central regulator [PMC9454643].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGUCCUCCAGGAGCUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Bos taurus bta-miR-339a
  2. Cervus elaphus cel-miR-339
  3. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8223939
  4. Tursiops truncatus miR-339
Publications