v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-423-3p URS00000BE495_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCUCGGUCUGAGGCCCCUCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Bos taurus Bta-Mir-423_3p (mature (co-guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-423-3p
  3. Canis lupus familiaris (dog) Cfa-Mir-423_3p (mature (co-guide))
  4. Capra hircus chi-miR-423-3p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-423-3p
  6. Cervus elaphus (red deer) cel-miR-423-3p
  7. Cricetulus griseus cgr-miR-423-3p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-423-3p
  9. Daubentonia madagascariensis dma-miR-423
  10. Echinops telfairi Ete-Mir-423_3p (mature (co-guide))
  11. Equus caballus (horse) eca-miR-423-3p
  12. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-100653
  13. Homo sapiens (human) hsa-miR-423-3p
  14. Macaca mulatta mml-miR-423-3p
  15. Mus musculus mmu-miR-423-3p
  16. Nomascus leucogenys nle-miR-423
  17. Otolemur garnettii (small-eared galago) oga-miR-423
  18. Pan paniscus ppa-miR-423
  19. Pan troglodytes (chimpanzee) ptr-miR-423
  20. Pongo pygmaeus (Bornean orangutan) ppy-miR-423-3p
  21. Pteropus alecto pal-miR-423-3p
  22. Rattus norvegicus rno-miR-423-3p
  23. Sus scrofa ssc-miR-423-3p
  24. Tupaia chinensis tch-miR-423-3p
 Publications