Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (domestic guinea pig) cpo-miR-423-3p URS00000BE495_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUCGGUCUGAGGCCCCUCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Bos taurus Bta-Mir-423_3p (mature (co-guide))
  2. Callithrix jacchus cja-miR-423-3p
  3. Canis lupus familiaris Cfa-Mir-423_3p (mature (co-guide))
  4. Capra hircus (goat) chi-miR-423-3p
  5. Cervus elaphus cel-miR-423-3p
  6. Cricetulus griseus (Chinese hamster) cgr-miR-423-3p
  7. Dasypus novemcinctus dno-miR-423-3p
  8. Daubentonia madagascariensis (aye-aye) dma-miR-423
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-423_3p (mature (co-guide))
  10. Equus caballus (horse) eca-miR-423-3p
  11. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-100653
  12. Homo sapiens hsa-miR-423-3p
  13. Macaca mulatta (Rhesus monkey) mml-miR-423-3p
  14. Mus musculus (house mouse) mmu-miR-423-3p
  15. Nomascus leucogenys nle-miR-423
  16. Oryctolagus cuniculus ocu-miR-423-3p
  17. Otolemur garnettii (small-eared galago) oga-miR-423
  18. Pan paniscus ppa-miR-423
  19. Pan troglodytes ptr-miR-423
  20. Pongo pygmaeus (Bornean orangutan) ppy-miR-423-3p
  21. Pteropus alecto pal-miR-423-3p
  22. Rattus norvegicus (Norway rat) rno-miR-423-3p
  23. Sus scrofa ssc-miR-423-3p
  24. Tupaia chinensis (Chinese tree shrew) tch-miR-423-3p