Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-423-3p URS00000BE495_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-423: Hsa-mir-423 is a microRNA that has been studied in relation to various diseases. The genotype frequencies for hsa-mir-423 rs6505162 C>A polymorphism in the control group were found to be in Hardy-Weinberg equilibrium (HWE) [PMC3832359]. This polymorphism has been associated with a reduced risk of breast cancer and is significantly associated with overall and recurrence-free survival in colorectal cancer patients [PMC9281991]. In a study comparing low and high expression of hsa-mir-423, it was found to be differentially expressed and consistent with the findings of another study by Rothe et al [PMC4433233]. The other miRNAs that were differentially expressed in this study included let-7i, hsa-miR-379, and hsa-miR-422a [PMC4433233]. These findings suggest that hsa-mir-423 may play a role in the development and progression of various diseases. Further research is needed to fully understand its mechanisms and potential therapeutic implications.

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUCGGUCUGAGGCCCCUCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Bos taurus Bta-Mir-423_3p (mature (co-guide))
  2. Callithrix jacchus cja-miR-423-3p
  3. Canis lupus familiaris Cfa-Mir-423_3p (mature (co-guide))
  4. Capra hircus (goat) chi-miR-423-3p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-423-3p
  6. Cervus elaphus cel-miR-423-3p
  7. Cricetulus griseus (Chinese hamster) cgr-miR-423-3p
  8. Dasypus novemcinctus dno-miR-423-3p
  9. Daubentonia madagascariensis (aye-aye) dma-miR-423
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-423_3p (mature (co-guide))
  11. Equus caballus (horse) eca-miR-423-3p
  12. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-100653
  13. Macaca mulatta (Rhesus monkey) mml-miR-423-3p
  14. Mus musculus (house mouse) mmu-miR-423-3p
  15. Nomascus leucogenys nle-miR-423
  16. Oryctolagus cuniculus ocu-miR-423-3p
  17. Otolemur garnettii (small-eared galago) oga-miR-423
  18. Pan paniscus ppa-miR-423
  19. Pan troglodytes ptr-miR-423
  20. Pongo pygmaeus (Bornean orangutan) ppy-miR-423-3p
  21. Pteropus alecto pal-miR-423-3p
  22. Rattus norvegicus (Norway rat) rno-miR-423-3p
  23. Sus scrofa ssc-miR-423-3p
  24. Tupaia chinensis (Chinese tree shrew) tch-miR-423-3p
Publications