Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) cja-miR-423-3p URS00000BE495_9483

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Callithrix jacchus. Annotated by 1 database (miRBase). Found in the Callithrix jacchus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGCUCGGUCUGAGGCCCCUCAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Bos taurus (cattle) Bta-Mir-423_3p (mature (co-guide))
    2. Canis lupus familiaris Cfa-Mir-423_3p (mature (co-guide))
    3. Capra hircus chi-miR-423-3p
    4. Cavia porcellus cpo-miR-423-3p
    5. Cervus elaphus cel-miR-423-3p
    6. Cricetulus griseus cgr-miR-423-3p
    7. Dasypus novemcinctus dno-miR-423-3p
    8. Daubentonia madagascariensis dma-miR-423
    9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-423_3p (mature (co-guide))
    10. Equus caballus eca-miR-423-3p
    11. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-100653
    12. Homo sapiens (human) hsa-miR-423-3p
    13. Macaca mulatta mml-miR-423-3p
    14. Mus musculus mmu-miR-423-3p
    15. Nomascus leucogenys nle-miR-423
    16. Oryctolagus cuniculus ocu-miR-423-3p
    17. Otolemur garnettii (small-eared galago) oga-miR-423
    18. Pan paniscus (pygmy chimpanzee) ppa-miR-423
    19. Pan troglodytes (chimpanzee) ptr-miR-423
    20. Pongo pygmaeus (Bornean orangutan) ppy-miR-423-3p
    21. Pteropus alecto (black flying fox) pal-miR-423-3p
    22. Rattus norvegicus (Norway rat) rno-miR-423-3p
    23. Sus scrofa (pig) ssc-miR-423-3p
    24. Tupaia chinensis tch-miR-423-3p