Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla ggo-miR-124a (MIR124A) URS00000B89C8_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAGGCACGCGGUGAAUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 76 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-124-P1-v2_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-124-P1-v2_3p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-124a
  4. Bos taurus (cattle) Bta-Mir-124-P1-v2_3p (mature (guide))
  5. Canis lupus familiaris (dog) Cfa-Mir-124-P1-v2_3p (mature (guide))
  6. Cavia porcellus (domestic guinea pig) Cpo-Mir-124-P1-v2_3p (mature (guide))
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-124-P1-v2_3p (mature (guide))
  8. Columba livia (rock pigeon) Cli-Mir-124-P1-v2_3p (mature (guide))
  9. Danio rerio (zebrafish) Dre-Mir-124-P1b-v2_3p (mature (guide))
  10. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-124-P1-v2_3p (mature (guide))
  11. Echinops telfairi Ete-Mir-124-P1-v2_3p (mature (guide))
  12. Eptatretus burgeri (inshore hagfish) Ebu-Mir-124-P5-v2_3p (mature (guide))
  13. Gadus morhua (Atlantic cod) Gmo-Mir-124-P1b-v2_3p (mature (guide))
  14. Gallus gallus gga-miR-124a-3p
  15. Gekko japonicus Gja-Mir-124-P1-v2_3p (mature (guide))
  16. Gorilla gorilla ggo-miR-124a
  17. Homo sapiens (human) Hsa-Mir-124-P1-v2_3p (mature (guide))
  18. Lagothrix lagotricha (brown woolly monkey) lla-miR-124a
  19. Lepisosteus oculatus (spotted gar) Loc-Mir-124-P1-v2_3p (mature (guide))
  20. Macaca fascicularis microRNA miR-124-3p
  21. Macaca mulatta (Rhesus monkey) mml-miR-124a-3p
  22. Microcaecilia unicolor Mun-Mir-124-P1-v2_3p (mature (guide))
  23. Monodelphis domestica mdo-miR-124a-3p
  24. Monopterus albus Mal-Mir-124-P1b-v2_3p (mature (guide))
  25. Mus musculus (house mouse) Mmu-Mir-124-P1-v2_3p (mature (guide))
  26. Ornithorhynchus anatinus (platypus) Oan-Mir-124-P1-v2_3p (mature (guide))
  27. Oryctolagus cuniculus Ocu-Mir-124-P1-v2_3p (mature (guide))
  28. Pan paniscus ppa-miR-124a
  29. Pan troglodytes (chimpanzee) ptr-miR-124a
  30. Pongo pygmaeus ppy-miR-124a
  31. Python bivittatus Pbv-Mir-124-P1-v2_3p (mature (guide))
  32. Rattus norvegicus (Norway rat) Rno-Mir-124-P1-v2_3p (mature (guide))
  33. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-124-P1-v2_3p (mature (guide))
  34. Scyliorhinus torazame (cloudy catshark) Sto-Mir-124-P1-v2_3p (mature (guide))
  35. Taeniopygia guttata (zebra finch) Tgu-Mir-124-P1-v2_3p (mature (guide))
  36. Tetraodon nigroviridis (spotted green pufferfish) Tni-Mir-124-P1b-v2_3p (mature (guide))
  37. Xenopus laevis (African clawed frog) Xla-Mir-124-P1c-v2_3p (mature (guide))
  38. Xenopus tropicalis (tropical clawed frog) xtr-miR-124
Publications