Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-miR-124 URS00000B89C8_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAGGCACGCGGUGAAUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Alligator mississippiensis Ami-Mir-124-P1-v2_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-124-P1-v2_3p (mature (guide))
  3. Ateles geoffroyi (black-handed spider monkey) age-miR-124a
  4. Bos taurus (cattle) Bta-Mir-124-P1-v2_3p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-124-P1-v2_3p (mature (guide))
  6. Cavia porcellus Cpo-Mir-124-P1-v2_3p (mature (guide))
  7. Chrysemys picta bellii Cpi-Mir-124-P1-v2_3p (mature (guide))
  8. Columba livia (rock pigeon) Cli-Mir-124-P1-v2_3p (mature (guide))
  9. Danio rerio (zebrafish) Dre-Mir-124-P1b-v2_3p (mature (guide))
  10. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-124-P1-v2_3p (mature (guide))
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-124-P1-v2_3p (mature (guide))
  12. Eptatretus burgeri Ebu-Mir-124-P5-v2_3p (mature (guide))
  13. Gadus morhua Gmo-Mir-124-P1b-v2_3p (mature (guide))
  14. Gallus gallus gga-miR-124a-3p
  15. Gekko japonicus Gja-Mir-124-P1-v2_3p (mature (guide))
  16. Gorilla gorilla gorilla ggo-miR-124a (MIR124A)
  17. Gorilla gorilla (western gorilla) ggo-miR-124a
  18. Homo sapiens Hsa-Mir-124-P1-v2_3p (mature (guide))
  19. Lagothrix lagotricha lla-miR-124a
  20. Lepisosteus oculatus (spotted gar) Loc-Mir-124-P1-v2_3p (mature (guide))
  21. Macaca fascicularis (crab-eating macaque) microRNA miR-124-3p
  22. Macaca mulatta (Rhesus monkey) mml-miR-124a-3p
  23. Microcaecilia unicolor Mun-Mir-124-P1-v2_3p (mature (guide))
  24. Monodelphis domestica (gray short-tailed opossum) mdo-miR-124a-3p
  25. Monopterus albus (swamp eel) Mal-Mir-124-P1b-v2_3p (mature (guide))
  26. Mus musculus Mmu-Mir-124-P1-v2_3p (mature (guide))
  27. Ornithorhynchus anatinus Oan-Mir-124-P1-v2_3p (mature (guide))
  28. Oryctolagus cuniculus Ocu-Mir-124-P1-v2_3p (mature (guide))
  29. Pan paniscus (pygmy chimpanzee) ppa-miR-124a
  30. Pan troglodytes ptr-miR-124a
  31. Pongo pygmaeus ppy-miR-124a
  32. Python bivittatus Pbv-Mir-124-P1-v2_3p (mature (guide))
  33. Rattus norvegicus (Norway rat) Rno-Mir-124-P1-v2_3p (mature (guide))
  34. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-124-P1-v2_3p (mature (guide))
  35. Scyliorhinus torazame Sto-Mir-124-P1-v2_3p (mature (guide))
  36. Taeniopygia guttata Tgu-Mir-124-P1-v2_3p (mature (guide))
  37. Tetraodon nigroviridis Tni-Mir-124-P1b-v2_3p (mature (guide))
  38. Xenopus laevis Xla-Mir-124-P1c-v2_3p (mature (guide))
Publications