Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-124a-3p URS00000B89C8_13616

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Monodelphis domestica. Annotated by 4 databases (ENA, RefSeq, miRBase, MirGeneDB). Monodelphis domestica (gray short-tailed opossum) mdo-miR-124a-3p sequence is a product of MIR124A-1, mdo-miR-124a, mdo-miR-124a-3p, MIR124A-3, MIR124A-2, miR-124, miR-124a, miR-124a-3p genes. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUAAGGCACGCGGUGAAUGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 37 other species

    1. Alligator mississippiensis Ami-Mir-124-P1-v2_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-124-P1-v2_3p (mature (guide))
    3. Ateles geoffroyi age-miR-124a
    4. Bos taurus Bta-Mir-124-P1-v2_3p (mature (guide))
    5. Canis lupus familiaris (dog) Cfa-Mir-124-P1-v2_3p (mature (guide))
    6. Cavia porcellus Cpo-Mir-124-P1-v2_3p (mature (guide))
    7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-124-P1-v2_3p (mature (guide))
    8. Columba livia Cli-Mir-124-P1-v2_3p (mature (guide))
    9. Danio rerio (zebrafish) Dre-Mir-124-P1b-v2_3p (mature (guide))
    10. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-124-P1-v2_3p (mature (guide))
    11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-124-P1-v2_3p (mature (guide))
    12. Eptatretus burgeri Ebu-Mir-124-P5-v2_3p (mature (guide))
    13. Gadus morhua Gmo-Mir-124-P1b-v2_3p (mature (guide))
    14. Gallus gallus gga-miR-124a-3p
    15. Gekko japonicus Gja-Mir-124-P1-v2_3p (mature (guide))
    16. Gorilla gorilla (western gorilla) ggo-miR-124a
    17. Homo sapiens (human) Hsa-Mir-124-P1-v2_3p (mature (guide))
    18. Lagothrix lagotricha lla-miR-124a
    19. Lepisosteus oculatus Loc-Mir-124-P1-v2_3p (mature (guide))
    20. Macaca fascicularis microRNA miR-124-3p
    21. Macaca mulatta mml-miR-124a-3p
    22. Microcaecilia unicolor Mun-Mir-124-P1-v2_3p (mature (guide))
    23. Monopterus albus (swamp eel) Mal-Mir-124-P1b-v2_3p (mature (guide))
    24. Mus musculus (house mouse) Mmu-Mir-124-P1-v2_3p (mature (guide))
    25. Ornithorhynchus anatinus Oan-Mir-124-P1-v2_3p (mature (guide))
    26. Oryctolagus cuniculus (rabbit) Ocu-Mir-124-P1-v2_3p (mature (guide))
    27. Pan paniscus (pygmy chimpanzee) ppa-miR-124a
    28. Pan troglodytes (chimpanzee) ptr-miR-124a
    29. Pongo pygmaeus ppy-miR-124a
    30. Python bivittatus Pbv-Mir-124-P1-v2_3p (mature (guide))
    31. Rattus norvegicus Rno-Mir-124-P1-v2_3p (mature (guide))
    32. Sarcophilus harrisii Sha-Mir-124-P1-v2_3p (mature (guide))
    33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-124-P1-v2_3p (mature (guide))
    34. Taeniopygia guttata Tgu-Mir-124-P1-v2_3p (mature (guide))
    35. Tetraodon nigroviridis Tni-Mir-124-P1b-v2_3p (mature (guide))
    36. Xenopus laevis Xla-Mir-124-P1c-v2_3p (mature (guide))
    37. Xenopus tropicalis (tropical clawed frog) xtr-miR-124
    Publications New