Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-196b URS00000B5C59_7955

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGGUAGUUUCAAGUUGUUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Cyprinus carpio ccr-miR-196b
  2. Salmo salar ssa-miR-196b-5p
  3. Takifugu rubripes (torafugu) fru-miR-196b
  4. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-196b
  5. Tor tambroides miR-196b
Publications