Salmo salar (Atlantic salmon) ssa-miR-196b-5p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Salmo salar (Atlantic salmon) ssa-miR-196b-5p URS00000B5C59_8030

22 nucleotides
1 database (miRBase)
Found in 5 other species
3 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UAGGUAGUUUCAAGUUGUUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Cyprinus carpio ccr-miR-196b
Danio rerio (zebrafish) dre-miR-196b
Takifugu rubripes fru-miR-196b
Tetraodon nigroviridis tni-miR-196b
Tor tambroides miR-196b

Publications