Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Gly (anticodon TCC) 1-1 (TRG-TCC1-1) secondary structure diagram

Homo sapiens (human) tRNA-Gly (anticodon TCC) 1-1 (TRG-TCC1-1) URS00000AED6F_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGUUGGUGGUAUAGUGGUUAGCAUAGCUGCCUUCCAAGCAGUUGACCCGGGUUCGAUUCCCGGCCAACGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 190 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  3. Albula glossodonta tRNA-OTHER
  4. Albula goreensis tRNA-Gly
  5. Alligator mississippiensis tRNA-Gly (TCC) (tRNA-Gly-TCC-4-1)
  6. Alligator sinensis (Chinese alligator) tRNA
  7. Alosa alosa tRNA-Gly
  8. Amazona aestiva tRNA
  9. Ameiurus melas (black bullhead) tRNA-Gly
  10. Anas platyrhynchos tRNA
  11. Anguilla anguilla (European eel) tRNA-Gly
  12. Anolis carolinensis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  13. Astyanax mexicanus (Mexican tetra) tRNA
  14. Balaenoptera acutorostrata scammoni tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  15. Bos taurus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  16. Callipepla squamata (scaled quail) tRNA
  17. Callithrix jacchus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  18. Camelus ferus (Wild Bactrian camel) tRNA
  19. Canis lupus familiaris tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  20. Carlito syrichta tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  21. Cavia porcellus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  22. Ceratotherium simum simum tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  23. Chaetura pelagica tRNA
  24. Chelonia mydas tRNA
  25. Chelydra serpentina (Common snapping turtle) tRNA-Gly
  26. Chlorocebus sabaeus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  27. Choloepus hoffmanni tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  28. Chrysemys picta bellii tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  29. Colinus virginianus (northern bobwhite) tRNA
  30. Columba livia (rock pigeon) partial tRNA-Gly
  31. Corvus brachyrhynchos tRNA
  32. Cuculus canorus tRNA
  33. Danio rerio tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1, tRNA-Gly-TCC-3-2)
  34. Dasypus novemcinctus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  35. Dipodomys ordii tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  36. Echinops telfairi tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  37. Egretta garzetta tRNA
  38. Eptesicus nilssonii tRNA-Gly
  39. Equus caballus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  40. Felis catus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  41. Ficedula albicollis tRNA
  42. Fukomys damarensis (Damara mole-rat) tRNA
  43. Gallus gallus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  44. Heterocephalus glaber tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  45. Ictidomys tridecemlineatus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  46. Lamprotornis superbus tRNA-OTHER
  47. Larimichthys crocea tRNA
  48. Latimeria chalumnae tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1)
  49. Lonchura striata domestica (Bengalese finch) tRNA
  50. Loxodonta africana tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  51. Macaca mulatta tRNA-Gly (TCC) (tRNA-Gly-TCC-5-1)
  52. Manacus vitellinus tRNA
  53. Marmota monax (woodchuck) tRNA.Gly
  54. Megalops atlanticus (tarpon) tRNA-Gly
  55. Meleagris gallopavo tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  56. Melopsittacus undulatus tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 4)
  57. Microcebus murinus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  58. Monodelphis domestica tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  59. Mustela putorius furo tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  60. Myotis brandtii tRNA
  61. Myotis davidii tRNA
  62. Myotis lucifugus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  63. Nematostella vectensis tRNA-Gly for anticodon UCC
  64. Nestor notabilis tRNA
  65. Nipponia nippon (crested ibis) tRNA
  66. Nomascus leucogenys tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  67. Notamacropus eugenii tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  68. Nothobranchius furzeri tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 6)
  69. Ochotona princeps tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  70. Ophiophagus hannah (king cobra) tRNA
  71. Opisthocomus hoazin tRNA
  72. Orbicella faveolata tRNA-Gly
  73. Oreochromis niloticus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  74. Ornithorhynchus anatinus tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  75. Oryzias latipes tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  76. Otolemur garnettii tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  77. Ovis aries tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  78. Pangasianodon gigas (Mekong giant catfish) tRNA-Gly
  79. Pangasianodon hypophthalmus tRNA-Gly
  80. Pangasius djambal tRNA-Gly
  81. Pan troglodytes tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  82. Papio anubis tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  83. Patagioenas fasciata monilis tRNA
  84. Pelodiscus sinensis tRNA
  85. Perca flavescens tRNA-Gly
  86. Perca fluviatilis tRNA-Gly
  87. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  88. Dryobates pubescens tRNA
  89. Pocillopora damicornis (Cauliflower coral) tRNA-Gly
  90. Podarcis lilfordi tRNA.Gly
  91. Poecilia formosa tRNA
  92. Pongo abelii tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  93. Procavia capensis tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  94. Pteropus alecto (black flying fox) tRNA
  95. Saimiri boliviensis boliviensis tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  96. Sarcophilus harrisii tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  97. Scleropages formosus (Asian bonytongue) tRNA
  98. Sorex araneus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  99. Sphaerodactylus townsendi tRNA-Gly
  100. Struthio camelus australis tRNA
  101. Sus scrofa tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  102. Taeniopygia guttata tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  103. Takifugu rubripes tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  104. Tetraodon nigroviridis tRNA
  105. Tinamus guttatus tRNA
  106. Trichechus manatus latirostris tRNA-Gly (TCC) (tRNA-Gly-TCC-6-1)
  107. Tupaia chinensis tRNA
  108. Tursiops truncatus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  109. Vicugna pacos tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
2D structure Publications