Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saimiri boliviensis boliviensis tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1) secondary structure diagram

Saimiri boliviensis boliviensis tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1) URS00000AED6F_39432

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGUUGGUGGUAUAGUGGUUAGCAUAGCUGCCUUCCAAGCAGUUGACCCGGGUUCGAUUCCCGGCCAACGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 112 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  3. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  4. Albula goreensis tRNA-Gly
  5. Alligator mississippiensis tRNA-Gly (TCC) (tRNA-Gly-TCC-4-1)
  6. Alligator sinensis tRNA
  7. Alosa alosa tRNA-Gly
  8. Amazona aestiva tRNA
  9. Ameiurus melas tRNA-Gly
  10. Anas platyrhynchos tRNA
  11. Anguilla anguilla tRNA-Gly
  12. Anolis carolinensis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  13. Astyanax mexicanus tRNA
  14. Ataeniobius toweri tRNA-Gly
  15. Balaenoptera acutorostrata scammoni tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  16. Bos taurus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  17. Callipepla squamata (scaled quail) tRNA
  18. Callithrix jacchus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  19. Camelus ferus tRNA
  20. Canis lupus familiaris tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  21. Carlito syrichta tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  22. Cavia porcellus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  23. Ceratotherium simum simum tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  24. Chaetura pelagica (chimney swift) tRNA
  25. Characodon lateralis tRNA-Gly
  26. Chelonia mydas (green seaturtle) tRNA
  27. Chelydra serpentina (Common snapping turtle) tRNA-Gly
  28. Chlorocebus sabaeus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  29. Choloepus hoffmanni tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  30. Chrysemys picta bellii tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  31. Colinus virginianus tRNA
  32. Columba livia partial tRNA-Gly
  33. Corvus brachyrhynchos (American crow) tRNA
  34. Crenichthys baileyi tRNA-Gly
  35. Cuculus canorus tRNA
  36. Danio rerio tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1, tRNA-Gly-TCC-3-2)
  37. Dasypus novemcinctus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  38. Dipodomys ordii tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  39. Echinops telfairi tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  40. Egretta garzetta tRNA
  41. Eptesicus nilssonii tRNA-Gly
  42. Equus caballus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  43. Felis catus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  44. Ficedula albicollis tRNA
  45. Fukomys damarensis tRNA
  46. Gallus gallus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  47. Heterocephalus glaber tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  48. Homo sapiens (human) tRNA-Gly (anticodon TCC) 1-1 (TRG-TCC1-1)
  49. Ictidomys tridecemlineatus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  50. Lamprotornis superbus tRNA-OTHER
  51. Larimichthys crocea tRNA
  52. Latimeria chalumnae tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1)
  53. Lonchura striata domestica tRNA
  54. Loxodonta africana tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  55. Macaca mulatta tRNA-Gly (TCC) (tRNA-Gly-TCC-5-1)
  56. Manacus vitellinus (golden-collared manakin) tRNA
  57. Marmota monax tRNA.Gly
  58. Megalops atlanticus (tarpon) tRNA-Gly
  59. Meleagris gallopavo tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  60. Melopsittacus undulatus tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 4)
  61. Microcebus murinus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  62. Monodelphis domestica tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  63. Mustela putorius furo tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  64. Myotis brandtii tRNA
  65. Myotis davidii tRNA
  66. Myotis lucifugus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  67. Nematostella vectensis tRNA-Gly for anticodon UCC
  68. Nestor notabilis tRNA
  69. Nipponia nippon (crested ibis) tRNA
  70. Nomascus leucogenys tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  71. Notamacropus eugenii tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  72. Nothobranchius furzeri tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 6)
  73. Ochotona princeps tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  74. Ophiophagus hannah tRNA
  75. Opisthocomus hoazin tRNA
  76. Orbicella faveolata (Mountainous star coral) tRNA-Gly
  77. Oreochromis niloticus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  78. Ornithorhynchus anatinus tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  79. Oryzias latipes tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  80. Otolemur garnettii tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  81. Ovis aries tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  82. Pangasianodon gigas tRNA-Gly
  83. Pangasianodon hypophthalmus tRNA-Gly
  84. Pangasius djambal tRNA-Gly
  85. Pan troglodytes tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  86. Papio anubis tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  87. Patagioenas fasciata monilis tRNA
  88. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  89. Perca flavescens tRNA-Gly
  90. Perca fluviatilis (European perch) tRNA-Gly
  91. Phrynosoma platyrhinos tRNA-OTHER
  92. Dryobates pubescens tRNA
  93. Pocillopora damicornis tRNA-Gly
  94. Podarcis lilfordi tRNA.Gly
  95. Poecilia formosa tRNA
  96. Pongo abelii tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1)
  97. Procavia capensis tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  98. Pteropus alecto tRNA
  99. Sarcophilus harrisii tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  100. Scleropages formosus tRNA
  101. Sorex araneus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  102. Sphaerodactylus townsendi tRNA-Gly
  103. Struthio camelus australis tRNA
  104. Sus scrofa tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  105. Taeniopygia guttata tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  106. Takifugu rubripes tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  107. Tetraodon nigroviridis tRNA
  108. Tinamus guttatus tRNA
  109. Trichechus manatus latirostris tRNA-Gly (TCC) (tRNA-Gly-TCC-6-1)
  110. Tupaia chinensis tRNA
  111. Tursiops truncatus tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
  112. Vicugna pacos tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1)
2D structure