Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-135a precursor (hsa-mir-135a-2) URS00000A7BEB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR135A2: MIR135A2 is a microRNA that has been investigated for its role in modulating midbrain development [PMC3861205]. In a study, the researchers aimed to determine if MIR135A2 is capable of repressing Lmx1b, a gene involved in midbrain development [PMC3861205]. To test this hypothesis, they conducted a luciferase assay in HEK293 cells [PMC3861205]. The results showed that MIR135A2 was able to repress a construct containing a fragment of the Lmx1b 3′UTR [PMC3861205]. However, when constructs with mutations within the evolutionarily conserved MIR135A2 binding site of the Lmx1b 3′UTR were used, repression was not observed [PMC3861205]. These findings suggest that MIR135A2 specifically targets and represses Lmx1b through its binding site within the 3′UTR of the gene [PMC3861205]. This study provides evidence for the role of MIR135A2 in modulating midbrain development by regulating Lmx1b expression [PMC3861205]. Further research is needed to fully understand the mechanisms and implications of this regulatory interaction [PMC3861205].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUAAAUUCACUCUAGUGCUUUAUGGCUUUUUAUUCCUAUGUGAUAGUAAUAAAGUCUCAUGUAGGGAUGGAAGCCAUGAAAUACAUUGUGAAAAAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 87 other species

  1. Ailuropoda melanoleuca (giant panda) microRNA 135a-2 (ENSAMEG00000023400.2)
  2. Aotus nancymaae miRNA (ENSANAG00000008981.1)
  3. Ateles geoffroyi microRNA age-mir-135 precursor (age-mir-135-2)
  4. Balaenoptera musculus microRNA 135a-2 (ENSBMSG00010009749.1)
  5. Bison bison bison (American bison) microRNA 135a-2 (ENSBBBG00000004197.1)
  6. Bos grunniens (domestic yak) microRNA 135a-2 (ENSBGRG00000005462.1)
  7. Bos indicus x Bos taurus (hybrid cattle) miRNA (ENSBIXG00000027928.1, ENSBIXG00005007804.1)
  8. Bos mutus (wild yak) microRNA 135a-2 (ENSBMUG00000005487.1)
  9. Bos taurus microRNA bta-mir-135a precursor (bta-mir-135a-2)
  10. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000023792.3)
  11. Camelus dromedarius (Arabian camel) microRNA 135a-2 (ENSCDRG00005019448.1)
  12. Canis lupus dingo microRNA 135a-2 (ENSCAFG00020023750.1)
  13. Canis lupus familiaris miRNA (ENSCAFG00000020605.2, ENSCAFG00030020656.1, ENSCAFG00040007327.1, ENSCAFG00845026490.1)
  14. Capra hircus (Goat) microRNA 135a-2 (ENSCHIG00000001032.1, ENSCHIG00010002969.1)
  15. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000022094.2)
  16. Catagonus wagneri (Chacoan peccary) microRNA 135a-2 (ENSCWAG00000012484.1)
  17. Cavia aperea microRNA 135a-2 (ENSCAPG00000002767.1)
  18. Cavia porcellus microRNA 135a-2 (ENSCPOG00000016373.3)
  19. Cebus imitator (Panamanian white-faced capuchin) microRNA 135a-2 (ENSCCAG00000013236.1)
  20. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000022935.1)
  21. Cervus hanglu yarkandensis microRNA 135a-2 (ENSCHYG00000019170.1)
  22. Chinchilla lanigera (Long-tailed chinchilla) microRNA 135a-2 (ENSCLAG00000020898.1)
  23. Chlorocebus sabaeus (African green monkey) microRNA 135a-2 (ENSCSAG00000022599.1)
  24. Colobus angolensis palliatus miRNA (ENSCANG00000007613.1)
  25. Dasypus novemcinctus (nine-banded armadillo) microRNA 135a-2 (ENSDNOG00000046946.1)
  26. Delphinapterus leucas (beluga whale) microRNA 135a-2 (ENSDLEG00000011524.1)
  27. Equus asinus asinus microRNA 135a-2 (ENSEASG00005019552.1)
  28. Equus asinus microRNA 135a-2 (ENSEASG00005019552.2)
  29. Equus caballus (horse) microRNA eca-mir-135a precursor (eca-mir-135a-2)
  30. Erinaceus europaeus (western European hedgehog) microRNA 135a-2 (ENSEEUG00000016024.1)
  31. Felis catus microRNA 135a-2 (ENSFCAG00000016628.3)
  32. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000002592.1)
  33. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-135a (ENSGGOG00000034388.2)
  34. Gorilla gorilla microRNA ggo-mir-135a precursor
  35. Heterocephalus glaber miRNA (ENSHGLG00100023971.2)
  36. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 135a-2 (ENSSTOG00000021762.1)
  37. Jaculus jaculus microRNA 135a-2 (ENSJJAG00000000803.1)
  38. Loxodonta africana (African savanna elephant) microRNA 135a-2 (ENSLAFG00000024685.1)
  39. Lynx canadensis (Canada lynx) microRNA 135a-2 (ENSLCNG00005004763.1)
  40. Macaca fascicularis (Crab-eating macaque) microRNA 135a-2 (ENSMFAG00000013275.2)
  41. Macaca mulatta microRNA mml-mir-135a precursor (mml-mir-135a-2)
  42. Macaca nemestrina miRNA (ENSMNEG00000021662.1)
  43. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000010721.1)
  44. Marmota marmota marmota (Alpine marmot) microRNA 135a-2 (ENSMMMG00000019911.1)
  45. Microcebus murinus microRNA 135a-2 (ENSMICG00000019314.3)
  46. Monodon monoceros microRNA 135a-2 (ENSMMNG00015013704.1)
  47. Moschus moschiferus (Siberian musk deer) microRNA 135a-2 (ENSMMSG00000024108.1)
  48. Mustela putorius furo (Domestic ferret) microRNA 135a-2 (ENSMPUG00000023066.1)
  49. Myotis lucifugus (little brown bat) microRNA 135a-2 (ENSMLUG00000017888.1)
  50. Neogale vison microRNA 135a-2 (ENSNVIG00000008348.1)
  51. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 135a-2 (ENSNLEG00000020379.2)
  52. Octodon degus (Degu) microRNA 135a-2 (ENSODEG00000022176.1)
  53. Oryctolagus cuniculus microRNA 135a-2 (ENSOCUG00000018977.1)
  54. Otolemur garnettii miRNA (ENSOGAG00000017568.1)
  55. Ovis aries miRNA (ENSOARG00000021275.1, ENSOARG00020011155.2)
  56. Pan paniscus microRNA ppa-mir-135 precursor (ppa-mir-135-2)
  57. Panthera leo microRNA 135a-2 (ENSPLOG00000013523.1)
  58. Panthera pardus miRNA (ENSPPRG00000013800.1, ENSPPRG00000013802.1)
  59. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002934.1)
  60. Pan troglodytes (chimpanzee) microRNA ptr-mir-135a precursor (ptr-mir-135a-2)
  61. Papio anubis (olive baboon) miRNA (ENSPANG00000013380.3)
  62. Phocoena sinus (vaquita) microRNA 135a-2 (ENSPSNG00000012081.1)
  63. Physeter catodon microRNA 135a-2 (ENSPCTG00005006725.1)
  64. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000002815.1)
  65. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000021546.2)
  66. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-135a precursor (ppy-mir-135a-2)
  67. Procavia capensis (cape rock hyrax) microRNA 135a-2 (ENSPCAG00000019550.1)
  68. Propithecus coquereli miRNA (ENSPCOG00000001016.1)
  69. Pteropus vampyrus microRNA 135a-2 (ENSPVAG00000026182.1)
  70. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 135a-2 (ENSRFEG00010018806.1)
  71. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000004444.1)
  72. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000012311.1)
  73. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000019388.1)
  74. Sciurus vulgaris microRNA 135a-2 (ENSSVLG00005005967.1)
  75. Sorex araneus (European shrew) microRNA 135a-2 (ENSSARG00000016182.1)
  76. Spermophilus dauricus miRNA (ENSSDAG00000004631.1)
  77. Suricata suricatta microRNA 135a-2 (ENSSSUG00005022196.1)
  78. Sus scrofa microRNA ssc-mir-135 precursor (ssc-mir-135-2)
  79. Theropithecus gelada microRNA 135a-2 (ENSTGEG00000003643.1)
  80. Tupaia belangeri (northern tree shrew) microRNA 135a-2 (ENSTBEG00000017967.1)
  81. Tursiops truncatus (bottlenosed dolphin) microRNA 135a-2 (ENSTTRG00000023102.1)
  82. Urocitellus parryii (Arctic ground squirrel) microRNA 135a-2 (ENSUPAG00010006218.1)
  83. Ursus americanus microRNA 135a-2 (ENSUAMG00000011076.1)
  84. Ursus maritimus (Polar bear) microRNA 135a-2 (ENSUMAG00000004207.1)
  85. Ursus thibetanus thibetanus microRNA 135a-2 (ENSUTTG00000016747.1)
  86. Vicugna pacos microRNA 135a-2 (ENSVPAG00000016793.1)
  87. Vulpes vulpes (red fox) microRNA 135a-2 (ENSVVUG00000018735.1)
  88. Zalophus californianus miRNA (ENSZCAG00015007502.1)
Publications