Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anas platyrhynchos tRNA secondary structure diagram

Anas platyrhynchos tRNA URS0000092302_8839

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGCGAUGGCCGAGUGGUUAAGGCGUUGGACUUGAAAUCCAAUGGGGUCUCCCCGCGCAGGUUCGAACCCUGCUCGCUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 114 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  3. Alligator mississippiensis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  4. Aptenodytes forsteri (emperor penguin) tRNA
  5. Balaenoptera acutorostrata scammoni tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  6. Balearica regulorum gibbericeps tRNA
  7. Bos taurus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  8. Buceros rhinoceros silvestris tRNA
  9. Callipepla squamata (scaled quail) tRNA
  10. Callithrix jacchus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  11. Calypte anna tRNA
  12. Camelus ferus (Wild Bactrian camel) tRNA
  13. Canis lupus familiaris tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  14. Antrostomus carolinensis tRNA
  15. Cariama cristata tRNA
  16. Carlito syrichta tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  17. Cathartes aura (turkey vulture) tRNA
  18. Cavia porcellus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  19. Ceratotherium simum simum tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  20. Cervus elaphus hippelaphus tRNA-Ser
  21. Chaetura pelagica (chimney swift) tRNA
  22. Charadrius vociferus tRNA
  23. Chelonia mydas (green seaturtle) tRNA
  24. Chelydra serpentina (Common snapping turtle) tRNA-Ser
  25. Chlorocebus sabaeus tRNA-Ser (TGA) (tRNA-Ser-TGA-4-1)
  26. Choloepus hoffmanni tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  27. Chrysemys picta bellii tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  28. Colinus virginianus tRNA
  29. Colius striatus (speckled mousebird) tRNA
  30. Columba livia (rock pigeon) partial tRNA-Ser
  31. Cricetulus griseus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  32. Cuculus canorus tRNA
  33. Dasypus novemcinctus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  34. Dipodomys ordii tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  35. Echinops telfairi tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  36. Eptesicus nilssonii tRNA-Ser
  37. Equus caballus tRNA-Ser (TGA) (tRNA-Ser-TGA-4-1)
  38. Erinaceus europaeus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  39. Felis catus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  40. Ficedula albicollis tRNA
  41. Fukomys damarensis (Damara mole-rat) tRNA
  42. Fulmarus glacialis (northern fulmar) tRNA
  43. Gallus gallus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  44. Gavia stellata tRNA
  45. Geospiza fortis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  46. Gorilla gorilla gorilla tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  47. Haliaeetus albicilla (white-tailed eagle) tRNA
  48. Heterocephalus glaber tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  49. Homo sapiens tRNA-Ser (anticodon TGA) 1-1 (TRS-TGA1-1)
  50. Ictidomys tridecemlineatus tRNA-Ser (TGA) (tRNA-Ser-TGA-4-1)
  51. Lamprotornis superbus tRNA-OTHER
  52. Latimeria chalumnae tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  53. Lepisosteus oculatus tRNA
  54. Leptosomus discolor tRNA
  55. Loxodonta africana tRNA-Ser (TGA) (tRNA-Ser-TGA-4-1)
  56. Macaca mulatta tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  57. Manacus vitellinus tRNA
  58. Marmota monax (woodchuck) tRNA.Ser
  59. Meleagris gallopavo tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  60. Melopsittacus undulatus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  61. Mesitornis unicolor tRNA
  62. Mesocricetus auratus tRNA
  63. Microcebus murinus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  64. Monodelphis domestica tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  65. Mus caroli tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  66. Mus musculus castaneus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  67. Mus musculus domesticus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  68. Mus musculus musculus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  69. Mus musculus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-2-1, tRNA-Ser-TGA-3-1)
  70. Mus pahari tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  71. Mus spretus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  72. Mustela putorius furo tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  73. Myotis brandtii tRNA
  74. Myotis davidii tRNA
  75. Myotis lucifugus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  76. Neotoma lepida (desert woodrat) tRNA
  77. Nestor notabilis tRNA
  78. Nipponia nippon tRNA
  79. Nomascus leucogenys tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  80. Notamacropus eugenii tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  81. Ochotona princeps tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  82. Ophiophagus hannah (king cobra) tRNA
  83. Opisthocomus hoazin tRNA
  84. Ornithorhynchus anatinus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  85. Oryctolagus cuniculus tRNA
  86. Otolemur garnettii tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  87. Ovis aries tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  88. Pan troglodytes tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  89. Papio anubis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  90. Patagioenas fasciata monilis tRNA
  91. Pelecanus crispus tRNA
  92. Phaethon lepturus tRNA
  93. Phrynosoma platyrhinos tRNA-OTHER
  94. Dryobates pubescens tRNA
  95. Podarcis lilfordi tRNA.Ser
  96. Podiceps cristatus (great crested grebe) tRNA
  97. Pongo abelii tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  98. Procavia capensis tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  99. Pterocles gutturalis tRNA
  100. Pteropus alecto tRNA
  101. Pygoscelis adeliae tRNA
  102. Rattus norvegicus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  103. Saimiri boliviensis boliviensis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  104. Sarcophilus harrisii tRNA-Ser (TGA) (tRNA-Ser-TGA-5-1)
  105. Sorex araneus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  106. Sphaerodactylus townsendi tRNA-Ser
  107. Struthio camelus australis tRNA
  108. Sus scrofa tRNA-Ser (TGA) (tRNA-Ser-TGA-4-1)
  109. Tinamus guttatus tRNA
  110. Trichechus manatus latirostris tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  111. Tupaia chinensis (Chinese tree shrew) tRNA
  112. Tursiops truncatus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  113. Tyto alba tRNA
  114. Vicugna pacos tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
2D structure Publications