Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Podiceps cristatus (great crested grebe) tRNA secondary structure diagram

Podiceps cristatus (great crested grebe) tRNA URS0000092302_345573

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGCGAUGGCCGAGUGGUUAAGGCGUUGGACUUGAAAUCCAAUGGGGUCUCCCCGCGCAGGUUCGAACCCUGCUCGCUGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 114 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  3. Alligator mississippiensis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  4. Anas platyrhynchos tRNA
  5. Aptenodytes forsteri (emperor penguin) tRNA
  6. Balaenoptera acutorostrata scammoni tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  7. Balearica regulorum gibbericeps tRNA
  8. Bos taurus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  9. Buceros rhinoceros silvestris tRNA
  10. Callipepla squamata (scaled quail) tRNA
  11. Callithrix jacchus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  12. Calypte anna tRNA
  13. Camelus ferus (Wild Bactrian camel) tRNA
  14. Canis lupus familiaris tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  15. Antrostomus carolinensis tRNA
  16. Cariama cristata tRNA
  17. Carlito syrichta tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  18. Cathartes aura (turkey vulture) tRNA
  19. Cavia porcellus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  20. Ceratotherium simum simum tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  21. Cervus elaphus hippelaphus tRNA-Ser
  22. Chaetura pelagica (chimney swift) tRNA
  23. Charadrius vociferus tRNA
  24. Chelonia mydas (green seaturtle) tRNA
  25. Chelydra serpentina (Common snapping turtle) tRNA-Ser
  26. Chlorocebus sabaeus tRNA-Ser (TGA) (tRNA-Ser-TGA-4-1)
  27. Choloepus hoffmanni tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  28. Chrysemys picta bellii tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  29. Colinus virginianus tRNA
  30. Colius striatus (speckled mousebird) tRNA
  31. Columba livia (rock pigeon) partial tRNA-Ser
  32. Cricetulus griseus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  33. Cuculus canorus tRNA
  34. Dasypus novemcinctus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  35. Dipodomys ordii tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  36. Echinops telfairi tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  37. Eptesicus nilssonii tRNA-Ser
  38. Equus caballus tRNA-Ser (TGA) (tRNA-Ser-TGA-4-1)
  39. Erinaceus europaeus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  40. Felis catus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  41. Ficedula albicollis tRNA
  42. Fukomys damarensis (Damara mole-rat) tRNA
  43. Fulmarus glacialis (northern fulmar) tRNA
  44. Gallus gallus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  45. Gavia stellata tRNA
  46. Geospiza fortis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  47. Gorilla gorilla gorilla tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  48. Haliaeetus albicilla (white-tailed eagle) tRNA
  49. Heterocephalus glaber tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  50. Homo sapiens tRNA-Ser (anticodon TGA) 1-1 (TRS-TGA1-1)
  51. Ictidomys tridecemlineatus tRNA-Ser (TGA) (tRNA-Ser-TGA-4-1)
  52. Lamprotornis superbus tRNA-OTHER
  53. Latimeria chalumnae tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  54. Lepisosteus oculatus tRNA
  55. Leptosomus discolor tRNA
  56. Loxodonta africana tRNA-Ser (TGA) (tRNA-Ser-TGA-4-1)
  57. Macaca mulatta tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  58. Manacus vitellinus tRNA
  59. Marmota monax (woodchuck) tRNA.Ser
  60. Meleagris gallopavo tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  61. Melopsittacus undulatus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  62. Mesitornis unicolor tRNA
  63. Mesocricetus auratus tRNA
  64. Microcebus murinus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  65. Monodelphis domestica tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  66. Mus caroli tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  67. Mus musculus castaneus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  68. Mus musculus domesticus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  69. Mus musculus musculus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  70. Mus musculus tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1, tRNA-Ser-TGA-2-1, tRNA-Ser-TGA-3-1)
  71. Mus pahari tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  72. Mus spretus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  73. Mustela putorius furo tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  74. Myotis brandtii tRNA
  75. Myotis davidii tRNA
  76. Myotis lucifugus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  77. Neotoma lepida (desert woodrat) tRNA
  78. Nestor notabilis tRNA
  79. Nipponia nippon tRNA
  80. Nomascus leucogenys tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  81. Notamacropus eugenii tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  82. Ochotona princeps tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  83. Ophiophagus hannah (king cobra) tRNA
  84. Opisthocomus hoazin tRNA
  85. Ornithorhynchus anatinus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  86. Oryctolagus cuniculus tRNA
  87. Otolemur garnettii tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  88. Ovis aries tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  89. Pan troglodytes tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  90. Papio anubis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  91. Patagioenas fasciata monilis tRNA
  92. Pelecanus crispus tRNA
  93. Phaethon lepturus tRNA
  94. Phrynosoma platyrhinos tRNA-OTHER
  95. Dryobates pubescens tRNA
  96. Podarcis lilfordi tRNA.Ser
  97. Pongo abelii tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  98. Procavia capensis tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  99. Pterocles gutturalis tRNA
  100. Pteropus alecto tRNA
  101. Pygoscelis adeliae tRNA
  102. Rattus norvegicus tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  103. Saimiri boliviensis boliviensis tRNA-Ser (TGA) (tRNA-Ser-TGA-1-1)
  104. Sarcophilus harrisii tRNA-Ser (TGA) (tRNA-Ser-TGA-5-1)
  105. Sorex araneus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  106. Sphaerodactylus townsendi tRNA-Ser
  107. Struthio camelus australis tRNA
  108. Sus scrofa tRNA-Ser (TGA) (tRNA-Ser-TGA-4-1)
  109. Tinamus guttatus tRNA
  110. Trichechus manatus latirostris tRNA-Ser (TGA) (tRNA-Ser-TGA-2-1)
  111. Tupaia chinensis (Chinese tree shrew) tRNA
  112. Tursiops truncatus tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
  113. Tyto alba tRNA
  114. Vicugna pacos tRNA-Ser (TGA) (tRNA-Ser-TGA-3-1)
2D structure Publications