v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-107 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-107 precursor URS000008F0CF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR107: MIR107, a type of microRNA, has been studied in relation to sepsis and Alzheimer's disease [PMC7310770]. Decreased expressions of MIR107 have been found to have good predictive values for increased 28-day mortality risk in sepsis patients [PMC7310770]. This suggests that MIR107 may be a potential early biomarker for sepsis [PMC7310770]. Additionally, the decreased expression of MIR107 has also been associated with the onset of Alzheimer's disease [PMC4870937]. The study found that peripheral MIR107 and BACE1 mRNA may be important in the development of Alzheimer's disease, indicating that MIR107 could be a candidate biomarker for early detection of the disease [PMC4870937]. These findings highlight the potential significance of MIR107 in both sepsis and Alzheimer's disease research, suggesting its potential as a diagnostic tool and therapeutic target [PMC7310770][PMC4870937].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCUCUGCUUUCAGCUUCUUUACAGUGUUGCCUUGUGGCAUGGAGUUCAAGCAGCAUUGUACAGGGCUAUCAAAGCACAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Aotus nancymaae microRNA 107 (ENSANAG00000012654.1)
  2. Bos taurus microRNA bta-mir-107 precursor
  3. Capra hircus chi-mir-107 (ENSCHIG00000001929.1)
  4. Carlito syrichta (Philippine tarsier) microRNA 107 (ENSTSYG00000020072.2)
  5. Cebus imitator (Panamanian white-faced capuchin) microRNA 107 (ENSCCAG00000000531.1)
  6. Cercocebus atys (Sooty mangabey) microRNA 107 (ENSCATG00000022342.1)
  7. Colobus angolensis palliatus miRNA (ENSCANG00000004211.1)
  8. Equus caballus microRNA eca-mir-107b precursor
  9. Gorilla gorilla gorilla ggo-mir-107 (ENSGGOG00000030824.2)
  10. Gorilla gorilla microRNA ggo-mir-107 precursor
  11. Lagothrix lagotricha microRNA lla-mir-107 precursor
  12. Macaca mulatta microRNA mml-mir-107 precursor
  13. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-107 precursor
  14. Mandrillus leucophaeus microRNA 107 (ENSMLEG00000013791.1)
  15. Microcebus murinus (gray mouse lemur) microRNA 107 (ENSMICG00000028671.2)
  16. Ovis aries (sheep) microRNA oar-mir-107 precursor
  17. Pan paniscus microRNA ppa-mir-107 precursor
  18. Pan troglodytes (chimpanzee) microRNA ptr-mir-107 precursor
  19. Pongo abelii miRNA
  20. Pongo pygmaeus microRNA ppy-mir-107 precursor
  21. Propithecus coquereli microRNA 107 (ENSPCOG00000001998.1)
  22. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 107 (ENSRBIG00000005736.1)
  23. Rhinopithecus roxellana microRNA 107 (ENSRROG00000004901.1)
  24. Saimiri boliviensis boliviensis microRNA 107 (ENSSBOG00000010457.1)
 2D structure Publications