Capra hircus (goat) chi-miR-409-5p URS0000081E1F_9925

• 23 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 26 other species
• 22 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AGGUUACCCGAGCAACUUUGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

1. Bos taurus bta-miR-409a
2. Canis lupus familiaris (dog) Cfa-Mir-154-P36_5p (mature (guide))
3. Cervus elaphus cel-miR-409a
4. Dasypus novemcinctus Dno-Mir-154-P36_5p (mature (co-guide))
5. Equus caballus (horse) eca-miR-409-5p
6. Homo sapiens hsa-miR-409-5p
7. Macaca mulatta mml-miR-409-5p
8. Mus musculus mmu-miR-409-5p
9. Nomascus leucogenys nle-miR-409
10. Ovis aries oar-miR-409-5p
11. Pongo pygmaeus ppy-miR-409-5p
12. Pteropus alecto (black flying fox) pal-miR-409-5p
13. Rattus norvegicus rno-miR-409a-5p

Publications Download

• FASTA
• JSON