v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) Cfa-Mir-154-P36_5p (mature (guide)) URS0000081E1F_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGGUUACCCGAGCAACUUUGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus bta-miR-409a
  2. Capra hircus (goat) chi-miR-409-5p
  3. Cervus elaphus cel-miR-409a
  4. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-154-P36_5p (mature (co-guide))
  5. Equus caballus eca-miR-409-5p
  6. Homo sapiens (human) hsa-miR-409-5p
  7. Macaca mulatta (Rhesus monkey) mml-miR-409-5p
  8. Mus musculus (house mouse) mmu-miR-409-5p
  9. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-409
  10. Ovis aries (sheep) oar-miR-409-5p
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-409-5p
  12. Pteropus alecto (black flying fox) pal-miR-409-5p
  13. Rattus norvegicus (Norway rat) rno-miR-409a-5p