Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-409-5p URS0000081E1F_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUUACCCGAGCAACUUUGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Bos taurus bta-miR-409a
  2. Canis lupus familiaris (dog) Cfa-Mir-154-P36_5p (mature (guide))
  3. Capra hircus chi-miR-409-5p
  4. Cervus elaphus cel-miR-409a
  5. Dasypus novemcinctus Dno-Mir-154-P36_5p (mature (co-guide))
  6. Homo sapiens hsa-miR-409-5p
  7. Macaca mulatta mml-miR-409-5p
  8. Mus musculus mmu-miR-409-5p
  9. Nomascus leucogenys nle-miR-409
  10. Ovis aries oar-miR-409-5p
  11. Pongo pygmaeus ppy-miR-409-5p
  12. Pteropus alecto (black flying fox) pal-miR-409-5p
  13. Rattus norvegicus rno-miR-409a-5p
Publications