Acyrthosiphon pisum (pea aphid) api-miR-275 URS000007EDA1_7029

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 8 other species
• 8 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UCAGGUACCUGAAGUAGCGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

1. Dinoponera quadriceps dqu-miR-275-3p
2. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-51463
3. Drosophila mojavensis miR-275-RA
4. Drosophila persimilis miR-275-RA
5. Drosophila virilis miR-275-RA
6. Drosophila willistoni miR-275-RA
7. Drosophila yakuba miR-275-RA
8. Polistes canadensis pca-miR-275-3p

Publications Download

• FASTA
• JSON