Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila yakuba miR-275-RA URS000007EDA1_7245

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGGUACCUGAAGUAGCGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Acyrthosiphon pisum (pea aphid) api-miR-275
  2. Dinoponera quadriceps dqu-miR-275-3p
  3. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-51463
  4. Drosophila mojavensis miR-275-RA
  5. Drosophila persimilis miR-275-RA
  6. Drosophila virilis miR-275-RA
  7. Drosophila willistoni miR-275-RA
  8. Polistes canadensis pca-miR-275-3p