v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Lactobacillus sp. 5S ribosomal RNA secondary structure diagram

Lactobacillus sp. 5S ribosomal RNA URS000007A3CA_1591

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUGGUGGCGAUAGCCAGAAGGAUACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUUCUGCACGCCAAGAGUAGUUGGGGGAUCGCCCCCUGCGAGGGUAGGACGUUGCCACGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Lentilactobacillus buchneri subsp. silagei CD034 5S ribosomal RNA
  2. Lentilactobacillus otakiensis 5S rRNA
  3. Lentilactobacillus buchneri 5S ribosomal RNA
  4. Lentilactobacillus buchneri NRRL B-30929 5S ribosomal RNA
  5. Lentilactobacillus kefiri 5S ribosomal RNA
  6. Lentilactobacillus parabuchneri 5S ribosomal RNA
  7. Lentilactobacillus sunkii 5S ribosomal RNA
 2D structure