Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Lactobacillus buchneri CD034 5S ribosomal RNA secondary structure diagram

Lactobacillus buchneri CD034 5S ribosomal RNA URS000007A3CA_1071400

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGGUGGCGAUAGCCAGAAGGAUACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUUCUGCACGCCAAGAGUAGUUGGGGGAUCGCCCCCUGCGAGGGUAGGACGUUGCCACGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Lentilactobacillus otakiensis 5S rRNA
  2. Lactobacillus sp. 5S ribosomal RNA
  3. Lentilactobacillus buchneri 5S ribosomal RNA
  4. Lentilactobacillus buchneri NRRL B-30929 5S ribosomal RNA
  5. Lentilactobacillus kefiri 5S ribosomal RNA
  6. Lentilactobacillus parabuchneri 5S ribosomal RNA
  7. Lentilactobacillus sunkii 5S ribosomal RNA
2D structure Publications