Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011396.1 secondary structure diagram

Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011396.1 URS0000079834_2794001

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGCCGUGGCUUAGUUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCGUGAGUUCGAAUCUCGCCGGGGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 113 other species

  1. Acanthoscelides obtectus tRNA
  2. Aethina tumida (Small hive beetle) transfer RNA threonine (anticodon AGU)
  3. Anastrepha ludens (Mexican fruit fly) transfer RNA threonine (anticodon AGU)
  4. Anastrepha obliqua (WestIndian fruit fly) transfer RNA threonine (anticodon AGU)
  5. Anthonomus grandis grandis (Boll weevil) transfer RNA threonine (anticodon AGU)
  6. Bactrocera dorsalis (Oriental fruit fly) tRNA-Thr
  7. Bactrocera latifrons (Solanum fruit fly) tRNA-Thr
  8. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA threonine (anticodon AGU)
  9. Bactrocera tryoni tRNA-Thr
  10. Bicyclus anynana tRNA-Thr
  11. Bombyx mandarina (Wild silkworm) tRNA-Thr
  12. Bombyx mori tRNA-Thr (AGT) (tRNA-Thr-AGT-4-1)
  13. Brassicogethes aeneus (rape pollen beetle) tRNA
  14. Brenthis ino (lesser marbled fritillary) tRNA
  15. Callosobruchus analis hypothetical protein
  16. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  17. Ceratitis capitata (Mediterranean fruit fly) tRNA-Thr
  18. Ceutorhynchus assimilis (cabbage seed weevil) tRNA
  19. Chrysodeixis includens tRNA
  20. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015249.1
  21. Ctenocephalides felis (Cat flea) tRNA-Thr
  22. Danaus chrysippus (African queen) tRNA
  23. Danaus plexippus plexippus tRNA
  24. Dendroctonus ponderosae (Mountain pine beetle) tRNA-Thr
  25. Diabrotica balteata tRNA
  26. Diabrotica virgifera virgifera (Western corn rootworm) transfer RNA threonine (anticodon AGU)
  27. Diatraea saccharalis (sugarcane borer) tRNA
  28. Diorhabda carinulata (Northern tamarisk beetle) transfer RNA threonine (anticodon AGU)
  29. Diorhabda sublineata (Subtropical tamarisk beetle) transfer RNA threonine (anticodon AGU)
  30. Drosophila albomicans (Fruit fly) transfer RNA threonine (anticodon AGU)
  31. Drosophila ananassae tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 9)
  32. Drosophila arizonae (Fruit fly) tRNA-Thr
  33. Drosophila biarmipes (Fruit fly) transfer RNA threonine (anticodon AGU)
  34. Drosophila bipectinata (Fruit fly) tRNA-Thr
  35. Drosophila busckii (Fruit fly) tRNA-Thr
  36. Drosophila buzzatii tRNA-Thr
  37. Drosophila elegans (Fruit fly) tRNA-Thr
  38. Drosophila erecta tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 8)
  39. Drosophila eugracilis (Fruit fly) tRNA-Thr
  40. Drosophila ficusphila (Fruit fly) tRNA-Thr
  41. Drosophila grimshawi tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 5)
  42. Drosophila guanche (Fruit fly) tRNA-Thr
  43. Drosophila gunungcola (Fruit fly) transfer RNA threonine (anticodon AGU)
  44. Drosophila hydei (Fruit fly) tRNA-Thr
  45. Drosophila innubila (Fruit fly) tRNA-Thr
  46. Drosophila kikkawai (Fruit fly) tRNA-Thr
  47. Drosophila mauritiana (Fruit fly) tRNA-Thr
  48. Drosophila melanogaster transfer RNA:Threonine-AGT 1-2 (multiple genes)
  49. Drosophila miranda (Fruit fly) tRNA-Thr
  50. Drosophila mojavensis tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 7)
  51. Drosophila navojoa (Fruit fly) tRNA-Thr
  52. Drosophila obscura (Fruit fly) tRNA-Thr
  53. Drosophila persimilis tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 7)
  54. Drosophila pseudoobscura (Fruit fly) tRNA-Thr
  55. Drosophila pseudoobscura pseudoobscura tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 7)
  56. Drosophila rhopaloa (Fruit fly) tRNA-Thr
  57. Drosophila santomea (Fruit fly) tRNA-Thr
  58. Drosophila sechellia tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 9)
  59. Drosophila simulans tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 8)
  60. Drosophila subobscura (Fruit fly) tRNA-Thr
  61. Drosophila subpulchrella (Fruit fly) tRNA-Thr
  62. Drosophila suzukii (Fruit fly) tRNA-Thr
  63. Drosophila takahashii (Fruit fly) tRNA-Thr
  64. Drosophila teissieri (Fruit fly) tRNA-Thr
  65. Drosophila virilis tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 7)
  66. Drosophila willistoni tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 4)
  67. Drosophila yakuba tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 8)
  68. Glossina austeni (Tsetse fly) tRNA tRNA-Thr
  69. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Thr
  70. Glossina fuscipes fuscipes tRNA
  71. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Thr
  72. Glossina pallidipes (Tsetse fly) tRNA tRNA-Thr
  73. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Thr
  74. Heliconius melpomene (Postman butterfly) tRNA HMEL002702
  75. Helicoverpa armigera transfer RNA threonine (anticodon AGU)
  76. Helicoverpa zea (Corn earworm) tRNA-Thr
  77. Heliothis virescens (tobacco budworm) tRNA
  78. Hermetia illucens tRNA-Thr
  79. Hypothenemus hampei tRNA-Thr
  80. Leguminivora glycinivorella (Soybean pod borer) tRNA-Thr
  81. Leptidea sinapis tRNA
  82. Leptinotarsa decemlineata (Colorado potato beetle) tRNA-Thr
  83. Lucilia cuprina tRNA-Thr for anticodon AGU
  84. Manduca sexta (Tobacco hornworm) tRNA-Thr
  85. Mayetiola destructor (Hessian fly) tRNA-Thr for anticodon AGU
  86. Megaselia scalaris tRNA-Thr for anticodon AGU
  87. Musca domestica (House fly) tRNA MDOA013456
  88. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005012963.1
  89. Nezara viridula (southern green stink bug) tRNA
  90. Onthophagus taurus (Dung beetle) tRNA-Thr
  91. Pararge aegeria aegeria tRNA
  92. Pararge aegeria tRNA-Thr (AGT) (tRNA-Thr-AGT-4 1 to 3)
  93. Arctia plantaginis Parasemia plantaginis tRNA
  94. Pectinophora gossypiella (Pink bollworm) transfer RNA threonine (anticodon AGU)
  95. Phyllotreta striolata tRNA
  96. Pieris brassicae (large cabbage white) tRNA
  97. Pieris macdunnoughi tRNA
  98. Plutella xylostella (diamondback moth) tRNA
  99. Psylliodes chrysocephalus Psylliodes chrysocephala tRNA
  100. Rhagoletis pomonella (Apple magot fly) tRNA-Thr
  101. Rhamnusium bicolor tRNA-Thr
  102. Rhynchophorus ferrugineus (red palm weevil) tRNA
  103. Scaptodrosophila lebanonensis tRNA
  104. Sitophilus oryzae (Rice weevil) tRNA-Thr
  105. Spodoptera exigua (beet armyworm) tRNA
  106. Spodoptera frugiperda tRNA-Thr (AGT) (tRNA-Thr-AGT-4 1 to 3)
  107. Spodoptera littoralis tRNA
  108. Spodoptera litura tRNA
  109. Stomoxys calcitrans (Stable fly) tRNA-Thr
  110. Trichoplusia ni (cabbage looper) tRNA
  111. Tropilaelaps mercedesae tRNA
  112. Vanessa tameamea tRNA
  113. Varroa destructor tRNA-Thr
  114. Varroa jacobsoni (Varroa mite) tRNA-Thr
  115. Zeugodacus cucurbitae (Melon fly) transfer RNA threonine (anticodon AGU)
  116. Zophobas morio tRNA
Relationships

Molecular Relationships

2D structure

Loading 2D structure...