v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) transfer RNA:Threonine-AGT 1-2 (multiple genes) secondary structure diagram

Drosophila melanogaster (fruit fly) transfer RNA:Threonine-AGT 1-2 (multiple genes) URS0000079834_7227

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCGCCGUGGCUUAGUUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCGUGAGUUCGAAUCUCGCCGGGGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 59 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Aethina tumida (Small hive beetle) transfer RNA threonine (anticodon AGU)
  3. Anthonomus grandis grandis (Boll weevil) transfer RNA threonine (anticodon AGU)
  4. Bactrocera dorsalis (Oriental fruit fly) tRNA-Thr
  5. Bactrocera latifrons (Solanum fruit fly) tRNA-Thr
  6. Bactrocera tryoni tRNA-Thr
  7. Bicyclus anynana (Squinting bush brown) tRNA-Thr
  8. Bombyx mandarina tRNA-Thr
  9. Bombyx mori tRNA-Thr (AGT) (tRNA-Thr-AGT-4-1)
  10. Callosobruchus analis hypothetical protein
  11. Callosobruchus chinensis hypothetical protein
  12. Ceratitis capitata tRNA-Thr
  13. Danaus plexippus plexippus tRNA
  14. Dendroctonus ponderosae tRNA-Thr
  15. Diabrotica virgifera virgifera (Western corn rootworm) transfer RNA threonine (anticodon AGU)
  16. Drosophila ananassae tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 9)
  17. Drosophila busckii tRNA
  18. Drosophila buzzatii tRNA-Thr
  19. Drosophila erecta tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 8)
  20. Drosophila ficusphila tRNA
  21. Drosophila grimshawi tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 5)
  22. Drosophila guanche tRNA.Thr
  23. Drosophila gunungcola tRNA-OTHER
  24. Drosophila mojavensis tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 7)
  25. Drosophila persimilis tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 7)
  26. Drosophila pseudoobscura pseudoobscura tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 7)
  27. Drosophila sechellia tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 9)
  28. Drosophila simulans tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 8)
  29. Drosophila virilis tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 7)
  30. Drosophila willistoni tRNA-Thr (AGT) (tRNA-Thr-AGT-2 1 to 4)
  31. Drosophila yakuba tRNA-Thr (AGT) (tRNA-Thr-AGT-1 1 to 8)
  32. Glossina austeni tRNA tRNA-Thr
  33. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Thr
  34. Glossina fuscipes fuscipes tRNA
  35. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Thr
  36. Glossina pallidipes (Tsetse fly) tRNA tRNA-Thr
  37. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Thr
  38. Heliconius melpomene tRNA HMEL002702
  39. Helicoverpa armigera (Cotton bollworm) transfer RNA threonine (anticodon AGU)
  40. Helicoverpa zea tRNA-Thr
  41. Hermetia illucens (Black soldier fly) tRNA-Thr
  42. Leguminivora glycinivorella (Soybean pod borer) tRNA-Thr
  43. Leptinotarsa decemlineata (Colorado potato beetle) tRNA-Thr
  44. Lucilia cuprina (Australian sheep blowfly) tRNA-Thr for anticodon AGU
  45. Manduca sexta (Tobacco hornworm) tRNA-Thr
  46. Mayetiola destructor tRNA-Thr for anticodon AGU
  47. Megaselia scalaris (Coffin fly) tRNA-Thr for anticodon AGU
  48. Musca domestica (House fly) tRNA MDOA013456
  49. Onthophagus taurus (Dung beetle) tRNA-Thr
  50. Pararge aegeria tRNA-Thr (AGT) (tRNA-Thr-AGT-4 1 to 3)
  51. Pectinophora gossypiella (Pink bollworm) transfer RNA threonine (anticodon AGU)
  52. Rhagoletis pomonella tRNA-Thr
  53. Rhamnusium bicolor tRNA-Thr
  54. Sitophilus oryzae (Rice weevil) tRNA-Thr
  55. Spodoptera frugiperda tRNA-Thr (AGT) (tRNA-Thr-AGT-4 1 to 3)
  56. Stomoxys calcitrans tRNA-Thr
  57. Tropilaelaps mercedesae tRNA
  58. Varroa destructor (Honeybee mite) tRNA-Thr
  59. Varroa jacobsoni (Varroa mite) tRNA-Thr
 2D structure