Mus musculus (house mouse) Mmu-Mir-493_5p (mature (co-guide)) URS0000077AED_10090

• 22 nucleotides
• 2 databases (MirGeneDB, PirBase)
• Found in 12 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. piRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UUGUACAUGGUAGGCUUUCAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Bos taurus (cattle) Bta-Mir-493_5p (mature (guide))
2. Callithrix jacchus cja-miR-493
3. Canis lupus familiaris (dog) Cfa-Mir-493_5p (mature (co-guide))
4. Capra hircus chi-miR-493-5p
5. Cervus elaphus cel-miR-493-5p
6. Homo sapiens (human) hsa-miR-493-5p
7. Macaca mulatta (Rhesus monkey) mml-miR-493-5p
8. Ovis aries (sheep) oar-miR-493-5p
9. Pan paniscus (pygmy chimpanzee) ppa-miR-493
10. Pteropus alecto pal-miR-493-5p
11. Rattus norvegicus (Norway rat) rno-miR-493-5p
12. Sus scrofa (pig) ssc-miR-493-5p

Download

• FASTA
• JSON