Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-493-5p URS0000077AED_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (RefSeq, miRBase, GeneCards, LncBase, MalaCards, MirGeneDB, IntAct, TarBase, ENA). Described in 38 papers. Homo sapiens (human) hsa-miR-493-5p sequence is a product of mir-RG-118, miR-493, hsa-mir-RG-118, MIR493, hsa-miR-493, hsa-miR-493-5p, miR-493-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 2A9, 3-10C, ADAM22, AF5Q31, AFF4, AFURS1, ALDH4, ALDH7, ALDH9, ALDH9A1.

Interactions 1

According to IntAct, Homo sapiens (human) hsa-miR-493-5p interacts with:

IntAct ID Participant Synonyms
EBI-26366949 intact:EBI-26366952 EBI-26366952 ENST00000434045 mrna_igf2-1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUGUACAUGGUAGGCUUUCAUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Bos taurus (cattle) Bta-Mir-493_5p (mature (guide))
    2. Callithrix jacchus cja-miR-493
    3. Canis lupus familiaris Cfa-Mir-493_5p (mature (co-guide))
    4. Capra hircus chi-miR-493-5p
    5. Cervus elaphus cel-miR-493-5p
    6. Macaca mulatta mml-miR-493-5p
    7. Mus musculus (house mouse) Mmu-Mir-493_5p (mature (co-guide))
    8. Ovis aries oar-miR-493-5p
    9. Pan paniscus ppa-miR-493
    10. Pteropus alecto pal-miR-493-5p
    11. Rattus norvegicus (Norway rat) rno-miR-493-5p
    12. Sus scrofa ssc-miR-493-5p