Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-29a-5p URS0000076995_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-29a: Rno-mir-29a is a miRNA that has been found to be significantly deregulated in certain conditions. In a study comparing SL- and PH-group, it was identified that rno-mir-29a was regulated in the opposite direction at the same time point compared to other miRNAs [PMC4198680]. The expression levels of rno-mir-29a were reduced in the mature rat cochleae [PMC4172914]. The expression of rno-mir-29a was analyzed using the miScript PCR system [PMC4338147]. Rno-mir-29a, along with rno-miR-29b and rno-miR-29c, were predicted to regulate target genes associated with bone formation at different time points [PMC3273934]. Rno-miR-29b and rno-miR-29c have slight mismatches compared to rno-mir-29a [PMC3895276]. Rno-mir-29a and rno-miR-200b can be distinguished from other members of their respective families using aLHCD [PMC3895276]. Rno-mir-29a and rno-miR-29b were predicted to target REST analyzed by TargetScan among dysregulated miRNAs [PMC4026383]. There were significant correlations found between Vipr1 transcripts and certain dysregulated miRNAs, including rmo-rmiR340, rmo-rmiR155, and rmo-rmir 2.9 a[PMC5979605]. Rmo-rmir 2.9 a peaked around neonatal stage (P0) either at its highest or lowest point[ PMC3441217].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGAUUUCUUUUGGUGUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Homo sapiens (human) hsa-miR-29a-5p
  2. Mus musculus (house mouse) mmu-miR-29a-5p
  3. Ornithorhynchus anatinus (platypus) oan-miR-29a-1-5p
  4. Pteropus alecto pal-miR-29a-5p
  5. Sus scrofa (pig) ssc-miR-29a-5p
Publications