Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-195 URS0000072D03_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-195: Bta-mir-195 is a differentially expressed microRNA (miRNA) that has been studied in various contexts. It has been found to be differentially expressed in theca cells during the estrous cycle, specifically at day 7 [PMC4156418]. Additionally, bta-mir-195 has been identified as a master regulator in the regulation of gene expression during different growth stages [PMC9445238]. It is downregulated in various contexts, including adipocyte differentiation and lipid deposition [PMC6876490] [PMC8727870]. Bta-mir-195 has been shown to target and inhibit the expression of thyroid hormone response protein (THRSP), leading to a decrease in lipogenesis and adipocyte differentiation [PMC8727870]. The expression of bta-mir-195 is significantly upregulated during adipocyte differentiation, suggesting its importance in later stages of differentiation [PMC8727870]. Bta-mir-195 has also been identified as a candidate hub miRNA with high gene significance and module-membership values [PMC8727870]. Overall, bta-mir-195 plays a significant role in regulating gene expression and cellular processes such as lipogenesis and adipocyte differentiation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAGAAAUAUUGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Canis lupus familiaris (dog) cfa-miR-195
  2. Cavia porcellus cpo-miR-195-5p
  3. Cervus elaphus cel-miR-195
  4. Cricetulus griseus cgr-miR-195
  5. Dasypus novemcinctus dno-miR-195-5p
  6. Echinops telfairi Ete-Mir-15-P2d_5p (mature (guide))
  7. Homo sapiens Hsa-Mir-15-P2d_5p (mature (guide))
  8. Macaca mulatta Mml-Mir-15-P2d_5p (mature (guide))
  9. Microcebus murinus (gray mouse lemur) mmr-miR-195
  10. Mus musculus Mmu-Mir-15-P2d_5p (mature (guide))
  11. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-195
  12. Oryctolagus cuniculus ocu-miR-195-5p
  13. Pteropus alecto (black flying fox) pal-miR-195-5p
  14. Rattus norvegicus (Norway rat) Rno-Mir-15-P2d_5p (mature (guide))
  15. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-15-P2d_5p (mature (guide))
  16. Tupaia chinensis tch-miR-195-5p
Publications