Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-195-5p URS0000072D03_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACAGAAAUAUUGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus bta-miR-195
  2. Canis lupus familiaris (dog) cfa-miR-195
  3. Cavia porcellus cpo-miR-195-5p
  4. Cervus elaphus cel-miR-195
  5. Cricetulus griseus cgr-miR-195
  6. Echinops telfairi Ete-Mir-15-P2d_5p (mature (guide))
  7. Homo sapiens Hsa-Mir-15-P2d_5p (mature (guide))
  8. Macaca mulatta Mml-Mir-15-P2d_5p (mature (guide))
  9. Microcebus murinus (gray mouse lemur) mmr-miR-195
  10. Mus musculus Mmu-Mir-15-P2d_5p (mature (guide))
  11. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-195
  12. Oryctolagus cuniculus ocu-miR-195-5p
  13. Pteropus alecto (black flying fox) pal-miR-195-5p
  14. Rattus norvegicus (Norway rat) Rno-Mir-15-P2d_5p (mature (guide))
  15. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-15-P2d_5p (mature (guide))
  16. Tupaia chinensis tch-miR-195-5p