Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR396f-5p URS000006A46E_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR396f-5p: Osa-mir396f-5p is a microRNA that has been found to be differentially expressed in rice upon infection with the fungus R. solani [PMC9189367]. The expression levels of the target gene REX1 for osa-mir396f-5p were authenticated [PMC8472271]. However, the expression patterns of osa-mir396f-5p and its target gene REX1 did not show a contrasting pattern, suggesting that REX1 may not be the actual target gene of osa-mir396f-5p [PMC8472271]. Osa-mir396f-5p was also found to be differentially expressed in response to different strains of R. solani, showing upregulation against Lud-1 and downregulation against Imph-2 and Chn-1 strains [PMC7662745]. Osa-mir396f-5p was also found to be induced in both susceptible and resistant rice cultivars upon infection with R. solani, suggesting its role as a basal response regulator against the pathogen [PMC7662745]. The multifaceted host resistance mechanisms in rice were suggested by the identification of osa-mir396f-5p along with other miRNAs involved in rice immunity against M. oryzae [PMC5066168]. The differential regulation of osa-mir396f-5p among different strains of R. solani suggests its involvement in strain-specific host-pathogen interactions [PMC7662745].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCACAGGCUUUCUUGAACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group microRNA osa-miR396f-5p
Publications