Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Solanum lycopersicum (tomato) sly-miR396a-3p URS0000068C18_4081

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

sly-miR396a-3p: Sly-mir396a-3p is a down-regulated miRNA in the M82 tomato variety but is up-regulated in the IL9-1 variety [PMC5485680]. It is one of the nine miRNAs that are down-regulated in M82 and up-regulated in IL9-1 [PMC5485680]. Sly-mir396a-3p is also one of the seven conserved miRNAs and three novel miRNAs that were selected for validation [PMC5485680]. In another study, sly-mir396a-3p was found to be down-regulated in M82 but up-regulated in IL9-1, along with sly-miR166c-5p [PMC8258350]. Sly-mir396a-3p was also identified as one of the miRNAs targeting polyamine transporter genes in tomato, specifically targeting Put7 and Put8 genes [PMC9952195]. In a comparison of two stresses, sly-mir396a-3p was found to be down-regulated while eight other miRNAs were up-regulated [PMC5499734]. Overall, sly-mir396a-3p shows differential regulation between tomato varieties and under different stress conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUCAAUAAAGCUGUGGGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR396a-3p
  2. Arabidopsis thaliana ath-miR396a-3p
  3. Citrus sinensis (sweet orange) csi-miR396b-3p
  4. Cynara cardunculus var. scolymus cca-miR396g
  5. Eugenia uniflora (Brazil-cherry) eun-miR396a-3p
  6. Fragaria vesca subsp. vesca fve-miR396c-3p
  7. Glycine max gma-miR396i-3p
  8. Medicago truncatula mtr-miR396b-3p
Publications