Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1931 (LINC01931) URS00000658C9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01931: LINC01931, also known as MMADHC divergent transcript, is a non-coding RNA located on chromosome 2 [PMC8770724]. In a study investigating risk factors for poor survival in lung squamous cell carcinoma (LSqCC) patients, LINC01931 was identified as one of the significant risk lincRNAs [PMC6900396]. High levels of LINC01931 were found to be associated with poor prognosis and predicted a lower survival rate in LSqCC patients [PMC6900396]. In particular, the 1-year, 5-year, and 10-year survival rates were significantly higher in the LINC01931 low-level subgroup compared to the high-level subgroup [PMC6900396]. Additionally, KM curves and lifetest analysis confirmed that high levels of LINC01931 were associated with poorer overall survival in LSqCC patients [PMC6900396]. The region where LINC01931 is located (2q23.3) has also been suggested to be associated with colorectal cancer in Hispanics [PMC6900396]. It is worth noting that lincRNAs often co-express with their neighboring genes and regulate their transcription. Therefore, it is possible that LINC01031, LINC01088, and LINC01931 may promote LSqCC through their neighboring genes [PMC6900396]. These findings suggest that targeting lincRNAs such as LINC01931 may hold promise for the treatment of LSqCC patients [PMC6900396]. References: - PMC8770724 - PMC6900396

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAAUUAAUGCUGAAACACAGCUAGCAUACAUAGCAAUAACUUAGGCAAAAAGGCAACACUCAAGCAAAAUCCUUCCUGGAAUUAAAAUCCUGUUAUUAGGUCAACCAACUUUUCUUUUAACUAACUAAAUAAACAACAGCAAGACAUGAAACCUAGACCUAUAAGUUUAGUACCUGAAUCUCUUGCUGAUUCAUGCAUUUCUAUUAAUCUUCUCAGUCAGAUGUUUAGCUCAGAUCUGUCCUCUUAUCCAAGCUUUUCCAAGAGUCUCCUAGCUACACUUCUGGCAUCAUGUUACACCCUACAAUCCAGCUCUUCACAGUCUCCUGACUUCUUUUUAAAAGUUGCAUACUAUAUAUACAUCUCUCUCUUGCUUAACAUUCCUCAGUUAUUCCCUAGUGGACACAGAAUAAAGUCUAGCUUCUUAGCAUGUUACUUGGGCUCCUUCAGUGCCAGUCCCCACAAAUUCCUCACUCAUCUUGCAGAAGCUCCCAGUUUUCAAUAUUCUCCUAAAUGCUGUGGAACCUCUGUCUAUGCAGGAUUCUAAAGAUGAGGAAAAUUAGUCCCUUAAGACUCAGCUUAAGCAUUGCCCCUUGUGCCUUUACUGUUAGUUUGCCCCUCUGUUCUUAAGAGUUUAUUCCUGGCAUUGCUCUUAAGGGAAGGAAGUUUGGCAGGGCCAAGAGUCCUAAACGUUAGACCUUUCUCUCUAAACACUAACAACAUUAAAACUCCAUUCAAGAAGGAGCAAAAGAAGCCAUCAUCUAGAAACAAUGUUGAUAACCACAGUUCCUGAACUUGGGCUUGUUAAAAGACUUUAUCUCCAUGAGUAUACUGAAACACAUAUUUAGUUUAUCUCCUAUUAUCAAGAAAGAAAUAUUAAAACUUCACUGUUGAGGAUCACUCUGAAUAUGAAAGUGCUCAAGACAAUCAAUCAGGUCUCGAGAUCUAGAAAUUAGUAUAAGUACUGAGUGCUAGGGGAAAAAAAUUAUACUCUUCAAACUACAUCCCUGGGAGUGUUAGUGAUGUCAUAAUUCACUGAGGAUCUAGAAACUACAGGAUGGAUACUUAUAAAAGAUAAGGGAAGUAUAGUGCAUAGGUUGCUGAGAGGUGGAGAGAAAGUUGCUUACUUUUCCUGAGCCUCAACUUUCUGAAAACAUAGAAACACAAUUAGAUGAUGAGUUAUGAGGUGAAGGAGGGGAUGACUCAGCAGCAAUGUGCCAGCUCCAUAGUGACUUCUCCACCAAGCUGGAGAAGGAUUUGCAGCAAUGGUUCCAGAACCAACUGUGUGUAUCUACAGGAUGAAGAUCAUUUAGACUAUGAUCAUUUAGACUGUAUCACUUUUGAUUCUUUCUAUGUUGCCCAGGCUGAUCUCAGAUUCCUGGGCUGAAGUGAUCCUCCUGCUUCAGCCUCCAGAGCAGCUGGGAUUACAGCAGCUUCAGUGCUGAGGCUAAUGGCAAAGGAAACACCAGGGGAUCAGUGAGUAAGAACUUGUCAAGGGAACAAAGUCUGAAGAUGGAACGGAGGAAGAGGAGAAAAUCUUCCACCAAAAAAAAUAUUAAAAUCUGAUCUUCAAGGAAAUACUGAAUCCACAUAGCACUCCCCUCCGCUCCCUUCUUAGGCACAGCAUUACUCACCAUCUCACAGAGGAGAAACAGAAAUAUAAAAUAAAAAGUGGAAACAAUCAUUAAAAAUACUUAGCCACUCCCACGUGUCCUGGGAAACUGAGAACACAGUAACUACCAAACAAAUUACAUGAUGUCACAUGCCAGAUACCUAAAGGAUAACAUCACCCCAUCUUCAGAAACAGAAGAAAAUAAAAUAGCAAAAGCAAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications