Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-30d URS000005CF5F_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-30d: Eca-mir-30d, a microRNA, was identified as the only miRNA in the dataset that qualified as an endogenous control [PMC8699634]. The relative quantification of candidate miRNAs was performed using the 2-ΔΔCq method, with eca-mir-30d serving as the endogenous control [PMC8699634]. In an exploratory NGS study, eca-mir-30d was found to have the lowest coefficient of variation (CV = 15.6) and was selected as the endogenous control [PMC8699634]. In an equine model of severe asthma, several miRNAs including eca-mir-30d were found to be differentially expressed in serum and were implicated in regulating airway remodeling and CD4+ T cell maturation and differentiation [PMC8372030]. Using DESeq2 analysis, 11 miRNAs including eca-mir-30d were identified as statistically significant differentially expressed miRNAs after accounting for hemolysis levels [PMC5748701]. Eca-mir-30d was selected as an endogenous control alongside cel-miR-39-3p as an exogenous control based on previous recommendations [PMC9873782].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCCCGACUGGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Anolis carolinensis (green anole) aca-miR-30d-5p
  2. Capra hircus (goat) miR-30d
  3. Danio rerio (zebrafish) dre-miR-30d
  4. Gallus gallus gga-miR-30d
  5. Gorilla gorilla gorilla ggo-miR-30d (MIR30D)
  6. Gorilla gorilla (western gorilla) ggo-miR-30d
  7. Homo sapiens (human) hsa-miR-30d-5p
  8. Macaca mulatta mml-miR-30d-5p
  9. Macaca nemestrina (pig-tailed macaque) mne-miR-30d
  10. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30e-5p
  11. Mus musculus mmu-miR-30d-5p
  12. Ovis aries (sheep) miscellaneous RNA
  13. Pan paniscus (pygmy chimpanzee) ppa-miR-30d
  14. Pan troglodytes ptr-miR-30d
  15. Pongo pygmaeus ppy-miR-30d
  16. Rattus norvegicus (Norway rat) rno-miR-30d-5p
  17. Takifugu rubripes (torafugu) fru-miR-30d
  18. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-30d
  19. Tor tambroides miR-30b
  20. Xenopus tropicalis xtr-miR-30d
Publications