Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30d-5p URS000005CF5F_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (ENA, MalaCards, GeneCards, miRBase, TarBase, LncBase, RefSeq). Described in 58 papers. Homo sapiens (human) hsa-miR-30d-5p sequence is a product of MIR30D, miR-30d-5p, miR-30d, miR-30, hsa-miR-30d-5p, hsa-miR-30d genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, 182-FIP, 1A1-3B, 1R20, 2HOR0202, 3'HEXO, 3-10C.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAAACAUCCCCGACUGGAAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Anolis carolinensis (green anole) aca-miR-30d-5p
    2. Capra hircus miR-30d
    3. Danio rerio (zebrafish) dre-miR-30d
    4. Equus caballus (horse) eca-miR-30d
    5. Gallus gallus (chicken) gga-miR-30d
    6. Gorilla gorilla ggo-miR-30d
    7. Macaca mulatta mml-miR-30d-5p
    8. Macaca nemestrina mne-miR-30d
    9. Monodelphis domestica mdo-miR-30e-5p
    10. Mus musculus (house mouse) mmu-miR-30d-5p
    11. Ovis aries miscellaneous RNA
    12. Pan paniscus ppa-miR-30d
    13. Pan troglodytes (chimpanzee) ptr-miR-30d
    14. Pongo pygmaeus (Bornean orangutan) ppy-miR-30d
    15. Rattus norvegicus (Norway rat) rno-miR-30d-5p
    16. Takifugu rubripes fru-miR-30d
    17. Tetraodon nigroviridis tni-miR-30d
    18. Tor tambroides (Thai mahseer) miR-30b
    19. Xenopus tropicalis (tropical clawed frog) xtr-miR-30d