Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-30d-5p URS000005CF5F_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCCCGACUGGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Anolis carolinensis (green anole) aca-miR-30d-5p
  2. Capra hircus (goat) miR-30d
  3. Danio rerio (zebrafish) dre-miR-30d
  4. Equus caballus (horse) eca-miR-30d
  5. Gallus gallus gga-miR-30d
  6. Gorilla gorilla gorilla ggo-miR-30d (MIR30D)
  7. Gorilla gorilla ggo-miR-30d
  8. Homo sapiens hsa-miR-30d-5p
  9. Macaca nemestrina (pig-tailed macaque) mne-miR-30d
  10. Monodelphis domestica mdo-miR-30e-5p
  11. Mus musculus mmu-miR-30d-5p
  12. Ovis aries (sheep) miscellaneous RNA
  13. Pan paniscus (pygmy chimpanzee) ppa-miR-30d
  14. Pan troglodytes (chimpanzee) ptr-miR-30d
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-30d
  16. Rattus norvegicus rno-miR-30d-5p
  17. Takifugu rubripes fru-miR-30d
  18. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-30d
  19. Tor tambroides (Thai mahseer) miR-30b
  20. Xenopus tropicalis (tropical clawed frog) xtr-miR-30d
Publications