Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-miR-30d URS000005CF5F_8364

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Xenopus tropicalis. Annotated by 3 databases (RefSeq, PirBase, miRBase). Described in 2 papers. Xenopus tropicalis (tropical clawed frog) xtr-miR-30d sequence is a product of xtr-miR-30d, miR-30d, mir30d, miR-30 genes. Found in the tropical clawed frog reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAAACAUCCCCGACUGGAAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 30 other species

    1. Anolis carolinensis aca-miR-30d-5p
    2. Capra hircus miR-30d
    3. Danio rerio (zebrafish) dre-miR-30d
    4. Equus caballus (horse) eca-miR-30d
    5. Gallus gallus (chicken) gga-miR-30d
    6. Gorilla gorilla (western gorilla) ggo-miR-30d
    7. Homo sapiens hsa-miR-30d-5p
    8. Macaca mulatta mml-miR-30d-5p
    9. Macaca nemestrina (pig-tailed macaque) mne-miR-30d
    10. Monodelphis domestica mdo-miR-30e-5p
    11. Mus musculus (house mouse) mmu-miR-30d-5p
    12. Ovis aries miscellaneous RNA
    13. Pan paniscus ppa-miR-30d
    14. Pan troglodytes (chimpanzee) ptr-miR-30d
    15. Pongo pygmaeus ppy-miR-30d
    16. Rattus norvegicus rno-miR-30d-5p
    17. Takifugu rubripes (torafugu) fru-miR-30d
    18. Tetraodon nigroviridis tni-miR-30d
    19. Tor tambroides miR-30b