Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-30e-5p URS000005CF5F_13616

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Monodelphis domestica. Annotated by 2 databases (miRBase, RefSeq). Described in 2 papers. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30e-5p sequence is a product of MIR30E, mdo-miR-30e-5p, miR-30e-5p, miR-30, mdo-miR-30e, miR-30e genes. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAAACAUCCCCGACUGGAAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 30 other species

    1. Anolis carolinensis aca-miR-30d-5p
    2. Capra hircus miR-30d
    3. Danio rerio (zebrafish) dre-miR-30d
    4. Equus caballus (horse) eca-miR-30d
    5. Gallus gallus (chicken) gga-miR-30d
    6. Gorilla gorilla (western gorilla) ggo-miR-30d
    7. Homo sapiens hsa-miR-30d-5p
    8. Macaca mulatta mml-miR-30d-5p
    9. Macaca nemestrina (pig-tailed macaque) mne-miR-30d
    10. Mus musculus (house mouse) mmu-miR-30d-5p
    11. Ovis aries miscellaneous RNA
    12. Pan paniscus ppa-miR-30d
    13. Pan troglodytes (chimpanzee) ptr-miR-30d
    14. Pongo pygmaeus ppy-miR-30d
    15. Rattus norvegicus rno-miR-30d-5p
    16. Takifugu rubripes (torafugu) fru-miR-30d
    17. Tetraodon nigroviridis tni-miR-30d
    18. Tor tambroides miR-30b
    19. Xenopus tropicalis xtr-miR-30d